... Tajikistan . Even before independence Tajikistan was the poorest of all the Soviet republics. ... However, official information on the level and patterns of income and expenditures suggests that poverty is a severe problem in Tajikistan. ... The empowerment of the poor and their participation in the process of development are critical for both reducing poverty and sustaining future growth. ... International assistance in the long-term is aimed at the sustainable development of local capacity. ...

Еще в разделе: (Показать все результаты (>145) - www.prof.msu.ru/ )

• Fulbright Program in Russia: Prospects and Problems of the Community of...

Syntax: %REVARG% . REVARG% If a topic revision is requested in the URL, it returns the revision of the current topic suitable for concatenation to the view query parameters. ... Expands to: (simulated) &rev=3 (actual) &rev=1 . ... This topic: System > WebHome > Macros > VarREVARG . Topic revision: revision 1 . Copyright by the contributing authors. All material on this site is the property of the contributing authors. Ideas, requests, problems regarding Foswiki? ...

Еще в разделе: (Показать все результаты (>48911) - wiki.cmc.msu.ru/ )

• VarADDTOZONE < System < Foswiki
• (backlinks in all Webs) VarQUERYPARAMS < System < Foswiki
• VarEXAMPLETAG < System < Foswiki

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>10) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

Evolution as a hard combinatorial problem D. Grigoriev, CNRS, Universitґ de Lille, dmitry.grigoryev@math.univ-lille1.fr e J.Reinitz, Dept.of Statistics, Chicago University, reinitz@galton.uchicago.edu S. Vakulenko, Institute for Mechanical Engineering Problems, Saint Petersburg, vakulenfr@mail.ru A. Weber, Computer Science Department, University of Bonn, weber@cs.uni-bonn.de We consider complexity emergence problem and formation of complex organs. ... The number n >> 1 is the gene number. ...

Еще в разделе: (Показать все результаты (>249) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/26.pdf
• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/16.pdf
• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/246.pdf

I have dropped the differentiation of HTML into a sequence of conformance levels. ... This (and upward compatible specifications) define the Internet Media Type (RFC 1590) and MIME Content Type (RFC 1521) called "text/html". The type "text/html" accepts the following parameters: . ... Character sets . The charset parameter (as defined in section 7.1.1 of RFC 1521) may be used with the text/html content type to specify the encoding used to represent the HTML document as a sequence of bytes. ...

Еще в разделе: (Показать все результаты (>140) - comet.sai.msu.ru/ )

• Index: P
• Problems using the ftp program
• Problems with logging in

... 3.0.3 - 3.0.18 only, PHP 4 >= 4.0.0) call_user_func -- Call a user function given by the first parameter . mixed call_user_func ( string function_name [, mixed parameter [, mixed .. Call a user defined function given by the function_name parameter. ... function barber ($type) { print "You wanted a $type haircut, no problem"; } call_user_func ('barber', "mushroom"); call_user_func ('barber', "shave"); . See also: call_user_func_array() , call_user_method() , call_user_method_array() . ...

Еще в разделе: (Показать все результаты (>619) - oit.cmc.msu.ru/ )

• pdf_get_parameter
• pdf_set_parameter
• testparm (1)

Network Working Group RFC #480 NIC #14949 James E. White SRI-ARC 8 March 73 Host-Dependent FTP Parameters This memo Bob Braden PROTOCOL Dependent The NIC decided enable VIEW of is in response to (and support of) one of the points raised by (RTB) of UCLA-CCN in RFC #430, COMMENTS ON FILE TRANSFER (see -- 13299,), namely that raised in Section D., SiteFTP ... To store and retrieve NLS files in sequential form, we will require that <program> be 'NLS' and <parameters> be of the form. ...

Еще в разделе: (Показать все результаты (>17322) - mirror.msu.net/ )

• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc480.txt
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/pdfrfc/rfc855.txt.pdf
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc855.txt

. N.N.Bogoliubov Institute for Theoretical Problems of Microphysics . M.V.Lomonosov Moscow State University . Choose encoding: . The URL for ITPM MSU Web Page is http://itpm.msu.su . If you have remarks or suggestions please send your comments to . (C) Copyright ITPM MSU 1997, 1998, 1999

Еще в разделе: (Показать все результаты (>360) - itpm.msu.su/ )

• Typically Used sendmail.m4 Parameters
• Ethernet Autoprobing
• All About ifconfig

... we show that the comparison between the calculated and observed numbers of the most ``fragile'' (from the point of view of the binary evolution scenario )   galactic binary types (such as X-ray low-mass X-ray binaries (LMXB), cataclysmic variables (CV),   Be-stars   with compact companions, relative number of visible binary radiopulsars   with normal and compact secondary components) impose certain constraints on the feasible initial ... Phenomenological Kick Velocity . ...

Еще в разделе: (Показать все результаты (>616) - xray.sai.msu.ru/ )

• Evolutionary Tracks
• Parameters of binary compact star evolution
• Parameters of the starburst

Lomonosov Moscow State University , Skobeltsyn Institute of Nuclear Physics . Online Services | ... Links | ... Contacts | ... CDFE => Online Services => Nucleus Ground and Isomeric States Parameters Search Engine . The source of data is the Nuclear Wallet Cards database prepared and maintained by the USA NNDC. ... Show nuclear moments/deformations for selected nuclei . ... Metastable states: . ... If you have any questions, comments, and/or suggestions, please, contact . ...

Еще в разделе: (Показать все результаты (>32) - cdfe.sinp.msu.ru/ )

• CDFE => Online Services => Relational ENSDF
• CDFE => Online services => Chart of nucleus shape and size parameters
• CDFE - Centre for Photonuclear Experiments Data - Home page

THE PHOTOMETRIC RESEARCHS OF THE MERCURY'S SURFACE BY MEANS OF DIGITAL MODELS. ... The surface brightness of Mercury was measured Danjon (1933, 1949, 1953) and Harris (1961) in phase angle 3o-123o. The analysis of the various data of the integral photometric gives the results of determination of the main photometric constants for Mercury. ... THE PHOTOMETRIC RESEARCHS OF THE MERCURY'S SURFACE: S.G. Pugacheva The surface brightness of the Mercurian images was established on the geologic map Mercury. ...

Еще в разделе: (Показать все результаты (>95) - selena.sai.msu.ru/ )

• http://selena.sai.msu.ru/Pug/Publications/ms42/m42_60.pdf
• http://selena.sai.msu.ru/Pug/Publications/ms34/MS058.pdf
• Problem 2000

... Department of Mathematics, . Faculty of Physics, MSU . ... Mathematical analysis 2 . Numerical Methods (A.N. Bogolyubov) . ... Asymptotic methods in nonlinear problems of mathematical physics . ... Extremal problems . ... Methods of finite differences in mathematical physics . ... 13 th Annual workshop will be organized by the of Department of Mathematics of Physics Faculty at Moscow State University , Moscow, Russia. ... Department of Mathematics, Faculty of Physics, Lomonosov MSU 2014-2016 ...

Еще в разделе: (Показать все результаты (>10) - math.phys.msu.ru/ )

: .. , . . , ., (e-mail: mchedlova@yandex.ru) , , , , religion, politics, secularism, religious identity, epistemology . , , , . This article examines the problem of interpretation of political reality in the light of increasing importance of the religious factor. The focus is on the need to find new epistemological framework different from the traditional secular paradigm, the new configurations of secular and religious, the religion as an identification parameter.

Еще в разделе: (Показать все результаты (>79) - vestnik.socio.msu.ru/ )

Head of sector, acting head of the Computational Geophysics Division of the M.V. Keldysh Institute for Applied Mathematics, RAS. ... Finished the Electrodynamics and Quantum Theory Department of Faculty of Physics, MSU in 1962. ... Ill-posed problems, stochastic processes, theory of approximation. Mechanics and physics of multi-phase media, phenomena in porous media, difference schemes for some classes of mathematical physics problems (filtration, elasticity theory). ...

Еще в разделе: (Показать все результаты (>5) - compmech.math.msu.su/ )

... Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika. ...

Еще в разделе: (Показать все результаты (>260) - vestnik.math.msu.su/ )

• Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika

Backlinks to VarQUERYPARAMS in all Webs ( Search System Web only ) . ... VarQUERYSTRING QUERYSTRING full, unprocessed string of parameters to this URL * String of all the URL parameters that were on the URL used to get to the current .. ... Number of topics: 1 . ... Copyright by the contributing authors. All material on this site is the property of the contributing authors. Ideas, requests, problems regarding Foswiki? ...

Еще в разделе: (Показать все результаты (>23263) - wiki.cs.msu.ru/ )

• (backlinks in System Web) VarQUERYPARAMS < System < Foswiki
• VarQUERYPARAMS < System < Foswiki
• SafeWikiPlugin < System < Foswiki

Brain Research Group >> Research >> Change-point analysis ... << previous next >> . ... It is necessary to note that a change-point detection method which we applied to a real EEG signal was developed on the basis of the piecewise stationarity model of the signal. ... The data presented in this Chapter demonstrate that the effective detection of the change-points opens the way for a number of new methods of the analysis of complex signals such as the EEG. ...

Еще в разделе: (Показать все результаты (>61) - brain.bio.msu.ru/ )

• Conclusion
• Parametric segmentation of the EEG
• Change-points at different levels of the hierarchy of EEG segmental...

... 119991, Moscow, GSP-1, Leninskiye Gory, MSU, 2nd Educational Building, CMC Faculty, rooms 590, 591 (Head of the laboratory), 62 . The Laboratory was established in 2001 to provide teaching and research in mathematical foundations of cryptography, cryptoanalysis, information and software security. ... The Laboratory of Mathematical Problems of Computer Security is performing a thorough research on mathematical problems in cryptoanalysis, information security, and program verification. ...

Еще в разделе: (Показать все результаты (>160) - en.cs.msu.ru/ )

• Laboratory of Mathematical Problems of Computer Security
• Department of Functional Analysis and its Applications | CMC MSU
• Laboratory of Inverse Problems | CMC MSU

... After the edit, recompile the kernel and recompile the Apache server then reboot. ... Addendum for very heavily loaded BSD servers . ... If you're running a really busy BSD Apache server, the following are useful things to do if the system is acting sluggish: . ... Here are some BSD kernel config parameters (actually BSDI, but pertinent to FreeBSD and other 4.4-lite derivatives) from a system getting heavy usage. ... Rebuilding the FreeBSD kernel on an AMD-133 (486-class CPU) web-server with . ...

Еще в разделе: (Показать все результаты (>806) - rtm-cs.sinp.msu.ru/ )

• Hints on Running a High-Performance Web Server
• Linux Threads Home Page: What are the common problems with threads?
• Bridging mini-Howto

... THE PARALLELIZATION OF COMPUTATIONAL ALGORITHMS IN LARGE PHYSICS PROBLEMS ON MULTIPROCESSOR COMPUTER SYSTEM CONTAINING THOUSAND AND MORE OF PROCESSOR ELEMENTS REQUIRES SPECIAL TOOLS. ... THE GENETIC ALGORITHM CAN BE CHARACTERIZED BY THE FOLLOWING PARAMETERS: - coding strategy, - population size, - initialisation strategy, - selection technique, - crossover mechanism, - mutation mechanism, - strategy for offspring inclusion. ... The results are presented on the following figure. ...

Еще в разделе: (Показать все результаты (>63) - acat02.sinp.msu.ru/ )

• http://acat02.sinp.msu.ru/presentations/huhlaev/Metamake.doc
• http://acat02.sinp.msu.ru/presentations/kolbasova/acat.pdf
• http://acat02.sinp.msu.ru/presentations/vaiciulis/acat2002.ps