... All circuit parameters have been presented in a symbolic form. ... To use the program you will need a CIR file (PSpise, DesignLab file) of your circuit. CIR file examples have been enclosured: bpasside.cir, test1.cir, test2.cir, test3.cir, test4.cir, laksamp.cir, bridge.cir, uA741acf.cir, quartz.cir. ... Ideal operational amplifier (nullor) * Nname n1 n2 n3 n4 * * In the ideal op amp data, (n1,n2) represent output nodes, * (n3,n4) represent input nodes (noninverting, inverting). ...

Еще в разделе: (Показать все результаты (>11) - astrometric.sai.msu.ru/ )

• Symbolic matrix processor

... Conserved factor . Compensated factor . Cluster factor . ... Part of sequence . ... Alignment Sequence . Include picture . No Picture Only Structure Structure and BP numbers Structure and Stem Energy Full Picture . ... Alignment OR sequence (without name). ... ANMF CGCGGGGTAGAGCAGCCTGGTAGCTCGTCGGGCTCATA AQTRNF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAA BGTRF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAT ANMF ATCCTCTCCCCGCC---- AQTRNF ATCCGCCTCCCGGCACCA BGTRF ATCCGCCTCCCGGCACCA . ...

Еще в разделе: (Показать все результаты (>143) - www.genebee.msu.ru/ )

... Alexander Popov QFTHE P' 2010 , Golitsyno, September 14 2 Program package E vtGen The EvtGen package has been created for the simulation of the bhadrons decays at B-factories. ... Lowest order SM contributions to the decays. ... Alexander Popov QFTHE P' 2010 , Golitsyno, September 14 5 E vtGen model for rare radiative leptonic B-decays We prepare the new EvtGen model BSTOGLLMNT for rare radiative leptonic B-mesons decays. ... Alexander Popov QFTHE P' 2010 , Golitsyno, September 14 11 ...

Еще в разделе: (Показать все результаты (>171) - qfthep.sinp.msu.ru/ )

• http://qfthep.sinp.msu.ru/talks2013/fcnc_presentation.pdf
• http://qfthep.sinp.msu.ru/talks2011/anomalous_wtb_qfthep11.pdf

extra:main ]] . CompHEP . ... Script for including cuts, kinematics, or regularizations into batch.dat file . Script for CompHep cross-sections energy dependence calculation . ... When you done CompHep calculations for the process under study at one energy, you may easely get cross-sections energy dependence running script cs_energy_dep.pl . ... For every energy point the script modifies results/batch.dat file and runs CompHep script num_batch.pl to calculate given process cross-sections. ...

Еще в разделе: (Показать все результаты (>14) - comphep.sinp.msu.ru/ )

• news [CompHEP]

... Data . ... Models . ... Paraboloid model . ... Dynamic paraboloid model (A2000) allows to calculate the variations of magnetic field of each magnetospheric large scale current systems by empirical data during quite and disturbed periods. ... The IMF penetrated into the magnetosphere as well as field-aligned currents magnetic field are included in the total magnetospheric magnetic field. ... bb(2,i) - ring current magnetic field; . ... BD is the geomagnetic dipole magnetic field at the Earth's...

Еще в разделе: (Показать все результаты (>34) - smdc.sinp.msu.ru/ )

• IGRF10 model - Space monitoring data center
• Space monitoring data center

... Другие названия журнала: Advances in Space Research (includes Cospar Information Bulletin , Advances in Space Research(includes Cospar Information Bulletin) . ... Lipunov V. в журнале Advances in Space Research (includes Cospar Information Bulletin) . ... Sajid M. , Chechenin N.G. , Torres F.S. , Khan E.U. , Agha S. в журнале Advances in Space Research (includes Cospar Information Bulletin) , том 56, с. 314-324 DOI . ...

Еще в разделе: (Показать все результаты (>1134) - istina.msu.ru/ )

• Virchows Archiv. B, Cell pathology including molecular pathology - журнал |

... Include forcefield parameters # include ./amber99sb.ff/forcefield.itp [ moleculetype ] ; Name nrexcl EGL 3 [ atoms ] ; nr type resnr residue atom cgnr charge mass typeB chargeB massB ; residue 1 EGL rtp EGL q 0.0 1 CT 1 EGL C1 1 0.0042 12.01 ; qtot 0.0042 2 H1 1 EGL H1 2 0.0553 1.008 ; qtot 0.0595 3 H1 1 EGL H2 3 0.0553 1.008 ; qtot 0.1148 4 H1 1 EGL H3 4 ...

Еще в разделе: (Показать все результаты (>2901) - kodomo.cmm.msu.ru/ )

• http://kodomo.cmm.msu.ru/~zhuravlka/term6/pr13/dimet.top
• http://kodomo.cmm.msu.ru/~golovin/bilayer/b.top
• http://kodomo.cmm.msu.su/trac/tanchiki/wiki/WikiProcessors?format=txt

Lomonosov Moscow State University , Skobeltsyn Institute of Nuclear Physics . Online Services | ... Links | ... Contacts | ... CDFE => Online Services => Nucleus Ground and Isomeric States Parameters Search Engine . The source of data is the Nuclear Wallet Cards database prepared and maintained by the USA NNDC. ... Show nuclear moments/deformations for selected nuclei . ... Metastable states: . ... If you have any questions, comments, and/or suggestions, please, contact . ...

Еще в разделе: (Показать все результаты (>29) - cdfe.sinp.msu.ru/ )

• CDFE => Online Services => Calculator and Graph Engine for Atomic Nuclei
• CDFE => Online services => Chart of nucleus shape and size parameters
• CDFE - Centre for Photonuclear Experiments Data - Home page

... Полная версия этой страницы: Чтение в массив строк . Студенческий форум Физфака МГУ > Физфак и учеба > Экзамены, зачеты, лекции, семинары, физпраки . ... надо считать их в массив строк.На Си. ... int main (int argc, char *argv[]) { . ... char data[255]; . ... char string_c[255][2048]; . ... массив размером 2048 на 255: 2048 макс строк в нем и 255 символов в строке. это не прога а полуфабрикат, добавь проверку на невылазанье из границы массива . ... char * tmpstr;//Заводим временную строку . ...

Еще в разделе: (Показать все результаты (>1230) - wasp.phys.msu.ru/ )

• Чтение в массив строк - Студенческий форум Физфака МГУ

University Satellites and . Space Science Education . ... The purpose of the developed scientific - educational program complex is creation on the Earth on the base of telemetry data of virtual model of microgravitational environment in which experiments are carried out, and virtual motion model of of the space vehicle. ... The developed program complex concerns to the class of the distributed program systems. ... Skobeltsyn Institute of Nuclear Physics, Moscow State University, 2005-2006 . ...

Еще в разделе: (Показать все результаты (>6703) - cosmos.msu.ru/ )

• Space Scientific and Education project of Lomonosov Moscow State University

SDPpred: a tool for prediction of amino acid residues that determine differences in functional specificity of homologous proteins . ... Amino acid residues that determine differences in protein functional specificity and account for correct recognition of interaction partners, are usually thought to correspond to those positions of a protein multiple alignment, where the distribution of amino acids is closely associated with grouping of proteins by specificity. ... As colored columns of the alignment. ...

Еще в разделе: (Показать все результаты (>227) - monkey.belozersky.msu.ru/ )

• HF clusters: algorithm
• About this project

LIB-DVM library. Preliminary design . ... Lib-DVM is Run-Time System for DVM-programs execution. A parallel Fortran DVM (or C-DVM) program is translated to the program in the standard Fortran 77 (or C) language extended by Lib-DVM function calls, and to be executed according to SPMD model on the each processor program is assigned to the task. ... Input of the parameters, controlling the operating of Run-Time System, DVM debugger and the accumulation subsystem of the execution characteristics. ...

Еще в разделе: (Показать все результаты (>179) - sp.cs.msu.ru/ )

• Fortran DVM compiler. Detailed design
• Lib-DVM. Detailed design
• HPF DVM. Language specification

This group allows you to probe a potential energy surface along a grid of points. The scan can be made for any SCFTYP, or for the MP2 or CI surface. IVEC1 = an array of two atoms, defining a coordinate from the first atom given to the second. ... DISP1 = step size for the coordinate. ... Press to view sample input file for GAMESS (US) style relaxed scans using DLCs . ... Download Firefly-specific samples on scans over internal coordinates using DLCs . ... New MP2 gradient code documentation . ...

Еще в разделе: (Показать все результаты (>127) - classic.chem.msu.su/ )

• Firefly v. 8.0.0 documentation - numerical gradients
• PC GAMESS/Firefly NBO MODULE DOCUMENTATION
• Firefly and PC GAMESS Version History

... Instructions are in README.TXT file inside the tarball. ... tar -xvf nhunt_x86.tar Query and database files should contain sequences in FASTA format ( wikipedia description ). ... Default name of the output file is 'nhunt.out'. ... Any parameter consists of key and value and is called as '-key value', where 'key' is one character and 'value' is any number of characters. -i Query file . ... No default value. -d Database file . ... No default value. -o Output file . ... Default value: 'nhunt.out' . ...

Еще в разделе: (Показать все результаты (>16) - mouse.genebee.msu.ru/ )

Division Information . ... Site Information . ... Analytical Chemistry Division at the Department of Chemistry, M. V. Lomonosov Moscow State University is the leading Russian center in analytical science and education . ... Division comprises of 5 research laboratories and education lab facilities. ... Postal address: Analytical Chemistry Division, Department of Chemistry, Lomonosov Moscow State University, Leninskie Gory 1, 119899 Moscow, Russia . ... Chemistry Department of Moscow State Univesity . ...

Еще в разделе: (Показать все результаты (>20) - analyt.chem.msu.ru/ )

• The Molecular Mechanic Approach to Coordination Compounds: Force Field Based on

MicroRNAs bind with mRNAs of genes involving in mitochondrial apoptosis pathway O.A. Berillo, A.T. Ivashchenko al-Farabi Kazakh National University, al-Farabi, av. ... The binding sites of 785 intergenic miRNAs, 686 intronic miRNAs, and 49 exonic miRNAs were investigated within the 5UTRs, CDSs, and 3UTRs of 38 mRNAs of genes participating in mitochondrial apoptosis pathway. ... The expression of host genes is also important as the target-genes because of intronic miRNA coexpression. ...

Еще в разделе: (Показать все результаты (>223) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/246.pdf
• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/116.pdf
• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/16.pdf

... Alternative core new atoms (%) . ... An alignment of a set of structures is a set of positions , to each position some atoms from different structures correspond. ... Geometrical core of a set of structures is a subset of alignment positions those atoms are disposed similarly in all structures. ... For any two positions included into geometrical core, the distances between CA atoms of those positions in all structures may differ not more than the value of the parameter "Distance spreading". ...

Еще в разделе: (Показать все результаты (>16) - mouse.belozersky.msu.ru/ )

• NPG-explorer

... Nonlinear FDTD-Modeling of Ultrasound Thermotherapy Including Temperature Dependent Tissue Parameters . ... It strongly depends on the counteracting processes of nonlinear ultrasound propagation and tissue attenuation. ... The temperature dependence of tissue parameters is taken into account for the complete model. ... Furthermore it is demonstrated that the temperature dependence of tissue parameters can not be neglected for accurate predictions of the required heating time. ...

Еще в разделе: (Показать все результаты (>197) - acs366.phys.msu.su/ )

• AUTHOR : Liebler M
• AUTHOR : Riedlinger R
• AUTHOR : Ginter S

... Further processing Only 3N events of ?good? runs of previous analysis are selected: 3N triggered events exist in every run Better accordance with MC for rates 150kHz (see elog 548 by Colas) GC triggered events excluded AaFit: -6.5 (Vladimir's presentation explains reason) Zenith angle 20° (in order to look only at events with vertical tracks) After 2008 2009 2010 all fi year year year ltres: -- 0.83107 -- 0.77107 -- 1.04107 - No evidence of possible anisotropy either. ...

Еще в разделе: (Показать все результаты (>20) - antares.sinp.msu.ru/ )

... Like ordinary make, metamake keeps platform-dependent files (object, executables, libraries) for repeated usage. To use the metamake, one must define basic project directories (task directory, target root, object directory etc) and prepare two simple files: task-file that contains common project settings (selected compilers, common system libraries etc) and architecture- independent Imake-file which includes project description along with compiler and linker directives. ...

Еще в разделе: (Показать все результаты (>62) - acat02.sinp.msu.ru/ )

• http://acat02.sinp.msu.ru/accomod.html
• http://acat02.sinp.msu.ru/presentations/ivanchenko/iv.pdf