Moscow State Lomonosov University and Moscow Mathematical Society . are organizing International Conference . Topology, analysis and applications to mathematical physics" . ... The conference will be held in Moscow from February 14 to February 19, 2005 . ... Geometry and topology, analysis, applications to mathematical physics . ... Moscow Mathematical Society, . ... Seminar on Topology and Analysis . ... e-mail: soloconf@mech.math.msu.su . ... Date of birth: . ... E-mail: . ...

Еще в разделе: (Показать все результаты (>48) - dfgm.math.msu.su/ )

• 2nd Announcement

... D42105 D42105.1 Escherichia coli genes for hypothetical protein, DEAH family RNA helicase, partial and complete cds . atgagcaaggtattagttcttaaatccagcatcctggcagggtactctcagtctaatcag ttgtcgattattttgttgaacaatggcgcgaaaagcactccgcgtgatgaaatcaccgtt cgcgacctggctgcaaatccgattccggtactggatggcgaactggttggcgctctgcgt ccgagcgatgcgccgctgactccgcgtcagcaggaagctctggcactttccgatgagttg attgccgagctgaaagcccacgacgttatcgttattgcggcaccgatgtataacttcaac ...

Еще в разделе: (Показать все результаты (>1984) - kodomo.cmm.msu.ru/ )

... Interface description . ... 6 Distributed array creating and deleting . ... 13.4 Access to elements of local part of distributed array . 13.4.1 Requesting if array element is allocated in local part of distributed array . ... 13.4.5 Coping element of local part of distributed array to element of local part of other distributed array . 13.4.6 Requesting address of element of local part of distributed array . ... 14.5 Access to distributed array elements, allocated in remote element buffer . ...

Еще в разделе: (Показать все результаты (>128) - sp.cs.msu.ru/ )

... Guidelines for Paper Submission . ... The program committee will schedule both oral and poster sessions. The abstract and summary of both oral and poster papers are published in the same manner in the Conference Program and the Technical Digest on CD-ROM. ... Oral Sessions . ... Poster Sessions . ... For poster sessions, authors are provided with bulletin boards on which to display their papers, along with a sign indicating their paper numbers, and pushтАУpins or adhesive tape. ... Program . ...

Еще в разделе: (Показать все результаты (>22) - iconolat13.phys.msu.ru/ )

Next: Name Lookups with DNS Up: The Domain Name System Previous: Hostname Resolution . DNS organizes host names in a hierarchy of domains. ... Below this top-level domain, each country's NIC is free to organize host names in whatever way they want. ... Now, organizing the name space in a hierarchy of domain names nicely solves the problem of name uniqueness; with DNS, a host name has to be unique only within its domain to give it a name different from all other hosts world-wide. ...

Еще в разделе: (Показать все результаты (>415) - itpm.msu.su/ )

• mod_auth_anon - Apache HTTP Server
• Hostname Resolution
• Name Lookups with DNS

... International Studies . ... Admission for International Students . ... For Students . ... General Russian Courses . ... The Faculty of Foreign Languages and Area Studies at Moscow State University offers courses of General Russian to learners of all levels from Absolute Beginners through to Advanced. ... Beginners I - This course aims to help the student to acquire some knowledge of basic Russian, so that s/he can communicate with Russians, using basic vocabulary and grammar to express him/herself. ...

Еще в разделе: (Показать все результаты (>169) - ffl.msu.ru/ )

• About Us

This module allows "anonymous" user access to authenticated areas. ... Source File: mod_auth_anon.c . ... This module does access control in a manner similar to anonymous-ftp sites; i.e. have a 'magic' user id 'anonymous' and the email address as a password. ... Anonymous_VerifyEmail The example below (when combined with the Auth directives of a htpasswd-file based (or GDM, mSQL etc. ) base access control system allows users in as 'guests' with the following properties: . ... Default: none . ...

Еще в разделе: (Показать все результаты (>332) - oit.cmc.msu.ru/ )

• swf_endshape
• readline_completion_function
• Definitions of terms used to describe Apache directives

This module allows "anonymous" user access to authenticated areas. ... Source File: mod_auth_anon.c . ... This module does access control in a manner similar to anonymous-ftp sites; i.e. have a 'magic' user id 'anonymous' and the email address as a password. ... Anonymous_VerifyEmail The example below (when combined with the Auth directives of a htpasswd-file based (or GDM, mSQL etc. ) base access control system allows users in as 'guests' with the following properties: . ... Default: none . ...

Еще в разделе: (Показать все результаты (>79) - neptun.sai.msu.ru/ )

• Definitions of terms used to describe Apache modules
• Anatoly V. Zasov

This module is contained in the mod_auth_anon.c file and is not compiled in by default. It is only available in Apache 1.1 and later. It allows "anonymous" user access to authenticated areas. It does access control in a manner similar to anonymous-ftp sites; i.e. have a 'magic' user id 'anonymous' and the email address as a password. ... This would allow the user to enter without password verification by using the userId's 'anonymous', 'AnonyMous','Not Registered' and 'I Don't Know'. ...

Еще в разделе: (Показать все результаты (>773) - rtm-cs.sinp.msu.ru/ )

• Qt Toolkit - QXtApplication member list
• Qt Toolkit - QApplication member list

Please send your abstract to Julia Martemyanova julia@polly.phys.msu.ru before May 20, 2010 !! Please send us only a PDF-file with your abstract. ... Please use Times New Roman font type 12 point size everywhere except the title. ... Author(s) first name is to appear before the surname for each author. Please list the name of the presenting author first. ... Author affiliations should include Name of institution, City, State and Country of origin: do not include street address. ...

Еще в разделе: (Показать все результаты (>226) - polly.phys.msu.ru/ )

• Publication list, Olga Shamardina
• Seminar in Polymer Physics

... Organizing committee . ... Selected papers of MCCMB'13 participants will be published in the Journal of Bioinformatics and Computational Biology . If you plan to submit your paper to the MCCMB issue of JBCB, please send to Prof. M.Gelfand (gelfand 'at' iitp.ru) a short message with a preliminary list of authors and a tentative title of your paper. ... September 30th, 2013 paper submission. ... Select a box stating that the paper goes to the MCCMB issue. ... January 30th, 2014 final decision. ...

Еще в разделе: (Показать все результаты (>179) - mccmb.belozersky.msu.ru/ )

• MCCMB'15

Главная . ... Адрес . ... Директор - профессор Вржещ Петр Владимирович . ... Адрес: 119991, Москва, Ленинские горы, МГУ, дом 1, стр. 12, Биологический факультет, каб. ... Медицинская биотехнология - профессор А.А.Каменский . ... Международный учебно-научный биотехнологический центр МГУ (МБЦ МГУ) организован в 1987 году. ... МБЦ МГУ повышает квалификации специалистов с высшим образованием на основе интеграции учебного процесса с научными исследованиями в области биотехнологии. ...

Еще в разделе: (Показать все результаты (>2) - biocentr.msu.ru/ )

... Conferences . ... International Scientific Conference "Probability Theory and its Applications" on Occasion of the 85-th Birthday of Yu.V.Prokhorov is organized by the Steklov Mathematical Institute , Faculty of Computational Mathematics and Cybernetics of Moscow State University , and Institute for Informatics Problems of Russian Academy of Sciences from 12 to 14 of February, 2015. ... CMC MSU students at GSIS Summer School, Tohoku University, Japan . ... CMC MSU тИТ GSIS Tohoku IT Joint Seminar . ...

Еще в разделе: (Показать все результаты (>262) - en.cs.msu.ru/ )

• Send by email | CMC MSU
• International project INARM of EU program Tempus-IV | CMC MSU

SPIE - The International Society for Optical Engineering Ukrainian and Russian Chapters First Announcement/Call for Papers The Seventh International Conference Correlation Optics The Sixth International Conference on Correlation Optics will be held in Chernivtsi , Ukraine on September 6-9, 2005 The purpose of the conference is to provide a discussion of novel approaches and advances connected with optical ... A list of preliminary prices for proposed hotels is given below. ...

Еще в разделе: (Показать все результаты (>288) - phys.msu.ru/ )

• http://phys.msu.su/upload/iblock/47c/NEPCAP%202012.pdf
• http://phys.msu.su/upload/iblock/2a9/first%20circular%20conference_2009.pdf
• http://phys.msu.su/upload/iblock/ac4/firstcircular.pdf

... The Department of Operations Research . April 9, 2016 . Welcome Traditional topics of the conference Important dates Abstracts Registration . Final program Accommodation Program committee Organizing committee . ... Moscow, April 10-14, 2007 Abstracts . ... An abstract should be prepared in MS Word according to the attached template. ... Abstracts should be sent by e-mail to io@cs.msu.su in an attached file. ... Accepted abstracts will be published in proceedings of the conference. ...

Еще в разделе: (Показать все результаты (>13) - io.cs.msu.ru/ )

• Contacts - ORM 2007
• Important dates - ORM 2007
• Program committee - ORM 2007

. 21.04.2014-23.04.2014 . Вход . Enter .

37. Abstract

38. Abstracts, Cultural Mediation of National History and Identity, a session at

39. http://geo.web.ru/~sgt/meeting/2001/2001_zonen/spb-second_circ.doc

40. Grants and contracts | Graphics and Media Lab