... Crystallographic data for a number of fragments of the IF protein vimentin is available [2] and can be used to model an elementary IF dimer, with computer simulations to fill-in the blanks. ... Results We have implemented the `divide-and-conquer' protein folding approach by customizing various Rosetta suite protocols [3], validating on a vimentin full-length dimer. ... The full dimer model was manually validated using available crystal structures of the vimentin fragments. ...

Еще в разделе: (Показать все результаты (>287) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/37.pdf
• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/134.pdf
• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/60.pdf

... Alignment Sequence . Include picture . No Picture Only Structure Structure and BP numbers Structure and Stem Energy Full Picture . Sequence name . Alignment OR sequence (without name). The usage of Alignment is strongly recommended. Alignment example: . ... ANMF CGCGGGGTAGAGCAGCCTGGTAGCTCGTCGGGCTCATA AQTRNF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAA BGTRF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAT ANMF ATCCTCTCCCCGCC---- AQTRNF ATCCGCCTCCCGGCACCA BGTRF ATCCGCCTCCCGGCACCA . ...

Еще в разделе: (Показать все результаты (>266) - www.genebee.msu.ru/ )

• Databases
• GEA :: Gene Expression Analysis

Электронная библиотека Попечительского совета . ... Ashcroft R. (ed.), Chinn S. (ed.) - Mathematics for Dyslexics: Including Dyscalculia . ... Название: Mathematics for Dyslexics: Including Dyscalculia . Авторы: Ashcroft R. (ed.), Chinn S. (ed.) . ... Mathematics for Dyslexics Third Edition provides a unique mix of background theory and practical classroom ideas that are structured and mathematically developmental. ... Электронная библиотека попечительского совета мехмата МГУ , 2004-2016 . ...

Еще в разделе: (Показать все результаты (>22349) - lib.mexmat.ru/ )

• Lamb H. - Statics. Including Hydrostatics and the Elements of the Theory of
• Kopper K. - The Linux Enterprise Cluster: Build a Highly Available Cluster with
• Поиск книг, содержащих #include :: Электронная библиотека попечительского

1284496101 -14400 # Node ID c323f5d5d6a94fc829f4a3479f0390aadf9eb1c4 # Parent 9cbace0709fcd6951a5a5cf5aecf08ecb9c39e5d compiled comment connect lines diff -r 9cbace0709fc -r c323f5d5d6a9 blocks3d-wt-widget.C --- a/blocks3d-wt-widget.C Wed Sep 15 00:05:57 2010 + 0400 +++ b/blocks3d-wt-widget.C Wed Sep 15 00:28:21 2010 + 0400 @@ -11,10 +11,10 @@ # include Wt/WMessageBox # include fstream +# include boost/lexical_cast.hpp - - ...

Еще в разделе: (Показать все результаты (>17846) - kodomo.fbb.msu.ru/ )

• allpy: 7c0559e23b4e debian/changelog
• allpy: 7c0559e23b4e debian/rules
• allpy: debian/rules annotate

... wiki: WikiProcessors . ... Processors are WikiMacros designed to provide alternative markup formats for the Wiki engine . Processors can be thought of as macro functions to process user-edited text . The Wiki engine uses processors to allow using Restructured Text , raw HTML and тАЛ textile in any Wiki text throughout Trac. To use a processor on a block of text, use a Wiki code block, selecting a processor by name using shebang notation (#!), familiar to most UNIX users from scripts. ...

Еще в разделе: (Показать все результаты (>3250) - kodomo.cmm.msu.ru/ )

• Available Reports тАУ Python Battle
• Available Reports тАУ Petri Dish
• Available Reports тАУ Cyclyc Cell Automata

... What Is Included In The Standard? Up: Introduction to MPI Next: What Is Not Included In The Standard? Previous: What Platforms Are Targets For Implementation? The standard includes: . Point-to-point communication . ... Communication contexts . ... Return to MPI Standard Index . Return to MPI home page . ... Центры . ...

Еще в разделе: (Показать все результаты (>648) - www.parallel.ru/ )

• What Is Not Included In The Standard? | PARALLEL.RU -
• Installing
  <tt> mpich
  </tt> for Others to Use | PARALLEL.RU -
• MPE_Num_colors | PARALLEL.RU - Информационно-аналитический центр по

This module provides for documents with Server Side Includes (SSI). ... Any document with handler of "server-parsed" will be parsed by this module, if the Includes option is set. If documents containing server-side include directives are given the extension .shtml, the following directives will make Apache parse them and assign the resulting document the mime type of text/html : AddType text/html .shtml AddHandler server-parsed .shtml The following directive must be given for ... cgi . ...

Еще в разделе: (Показать все результаты (>116) - neptun.sai.msu.ru/ )

• Apache Tutorial: Introduction to Server Side Includes
• Configuration Files
• Running a High-Performance Web Server for BSD

astro-ph/0207260 . ... Authors: John C. Hayes, Michael L. Norman . Comments: 57 pages (including 18 eps figures); submitted to the ApJ Supplement . ... Comments: submitted to Supercomputing 2002; 10 pages; 8 figures . ... astro-ph/0207448 . ... Comments: 41 pages, 8 figures. ... Commets: Contribution to the proceedings of the 4th International Workshop on the Identification of Dark Matter (IDM2002), held in York, England 2-6 September 2002, to be published by World Scientific. 10 pages, 1 figure . ...

Еще в разделе: (Показать все результаты (>422) - astro.uni-altai.ru/ )

• Новости науки
• Обзоры препринтов astro-ph

... GENERAL INFORMATION Registration Registration forms will be available in January 2010 at: 20th Polymer Networks Group Meeting in Goslar , Germany, Aug. 29th ­ Sep. 2nd, 2010 Invited speakers (CEN Saclay, France) FranГois BouИ (CU Boulder, USA ) Christopher N. Bowman (University of Cambridge, UK) Wilhelm Huck (UDEL Newark, USA ) Kristi L. Kiick (UNC Chapel Hill, USA ) Michael Rubinstein (IPF Dresden, Germany) Jens-Uwe Sommer (UW Seattle, ... chemically reversible networks, ! ...

Еще в разделе: (Показать все результаты (>487) - polly.phys.msu.ru/ )

• LCOptimizer Software
• Practicums - Chair of Polymer and Crystal Physics
• Science

Text can be included in the shell script by using a here document, a special form of input redirection. The << symbol is used to indicate that text should be read up to a given mark. For example: #!/bin/sh # this script outputs the given text before it runs cat << EOF This shellscript is currently under development, please report any problems to Danny (danny@cornflake.ed) EOF exec /usr/local/test/bin/test_version . ...

Еще в разделе: (Показать все результаты (>177) - comet.sai.msu.ru/ )

• Commands available in send mode
• Understanding HTML and SGML
• The Structure of HTML 3.0 Documents

... The molecular structure of acetone-chloroform mixtures has been studied. ... A molecular model including the formation of the 1:1 and 1:2 molecular complexes is substantiated. ... The thermodynamic parameters of complex formation was defined by the minimization procedure for the excess Gibbs energy of mixtures was applied for calculation of excess enthalpy and entropy as well as dielectric and optical properties of mixtures. ...

Еще в разделе: (Показать все результаты (>2377) - chem.msu.ru/ )

• Moscow University Chemistry Bulletin Vol. 44, No. 1, P. 16 (2003)
• Laboratory of Crystal Chemistry, Chemistry Department, Moscow State University
• PC Crystal Chemistry Analysis of Organic Crystal Structures

Firefly and PC GAMESS/Firely LARGE-SCALE PARALLEL MCSCF CODE DOCUMENTATION Throughout this document we'll denote "large-scale" any CI, MCSCF, MCQDPT2, or XMCQDPT2 calculations of systems having large number of basis functions (e.g., 1500) and relatively small active spaces (e.g., 12 electrons/12 orbitals). ... To speed up these stages, PC GAMESS/Firefly includes special fast direct and conventional integral transformation algorithms based on the fastints/gencon code. ... PC GAMESS/Firefly' NBO code . ...

Еще в разделе: (Показать все результаты (>122) - classic.chem.msu.su/ )

• Just CUDing: Firefly v. 7.1.G standard MP4(SDTQ) benchmark on NVidia GPUs or
• Firefly Home Page
• Firefly capabilities

Division Information . ... Site Information . ... Analytical Chemistry Division at the Department of Chemistry, M. V. Lomonosov Moscow State University is the leading Russian center in analytical science and education . ... Division comprises of 5 research laboratories and education lab facilities. ... Postal address: Analytical Chemistry Division, Department of Chemistry, Lomonosov Moscow State University, Leninskie Gory 1, 119899 Moscow, Russia . ... Chemistry Department of Moscow State Univesity . ...

Еще в разделе: (Показать все результаты (>76) - analyt.chem.msu.ru/ )

... The Linnaean Collection of the Herbarium of Moscow State University: digital images, comments, historical review. ... The Herbarium of Moscow State University (MW) is one of only a small number of Herbaria which possess original samples from Linnaeus? own collections. ... Some of them are almost certainly iso-lectotypes of Linnaean names. ... The CD-ROM contains digital images of every relevant specimen connected with Linnaeus (63 in total) preserved in the Herbarium of Moscow State University. ...

Еще в разделе: (Показать все результаты (>238) - herba.msu.ru/ )

• The Linnaean Collection of the Herbarium of Moscow State University: digital
• Index of /shipunov/school/biol_448/nd_keys/nd_plant_families/includes
• Index of /shipunov/school/biol_448/nd_keys/nd_labiatae/includes

... Policies to promote environmentally sound production methods; conservation and protection of natural resources; . ... Farm price policy and reduction of agricultural subsidies; . ... Credit; consumer credit; production credit; credit agencies; . Problems related to extension of short-term production credits; medium-term and long-term credits; investment and credit policies: demand and supply; economics, institutions; agricultural debt restructuring; mortgage systems; . ... Markets and trade; . ...

Еще в разделе: (Показать все результаты (>523) - www.fadr.msu.ru/ )

• Jennifer Abel COMMENTS ON PAPERS
• Report from the Secretary
• Фотоархив "EcoPhoto" - Order images - Calendars

... The scientific and investigating activities of the laboratory are spread in three main dimensions. ... Leading Research Associate Gibalov V.I. Assistant of professor Tkachenko S.N. Senior Research Associate Samoilovich V.G., Kozlov K.V., Popovich M.P. New Effective Enamel Coating of HF-ozonizers Electrodes . ... assistant of professor Antipenko E.E. Senior Research Associate Zosimov A.V. Ozone Including Oxidation Reactions . ... NON-TRADICIONAL METHODS OF CHEMICAL AND CATALYTIC REACTIONS PERFORMANCE...

Еще в разделе: (Показать все результаты (>51) - www.kge.msu.ru/ )

• Публикации

... BBA ? Biophysics including Photosynthesis [ BBA Biophys inc Photosynth] . Common information . ... no information] . ... 0926-6585 . ... since 1965-01-01 till 1966-12-01 . ... biology ->biophysics . ... Recently "BBA - Specialized Section on Biophysical Subjects". Now included into "BBA - Bioenergetics" and "BBA - Biomembranes". ... Elsevier Science . ... http://www.sciencedirect.com/science/.. ...

Еще в разделе: (Показать все результаты (>767) - journals.genebee.msu.ru/ )

... N.M. Emanuel Institute of Biochemical Physics, Russian Academy of Sciences . A.N. Bach Institute of Biochemistry, Russian Academy of Sciences . Advanced Biomedical Computing Center , National Cancer Institute at Frederick, MD, USA . Department of Chemistry, University of Southern California , Los Angeles, CA, USA . Department of Biomolecular Mechanisms, Max-Planck Institute for Medical Research, Heidelberg, Germany . ... Joint Supercomputer Center of the Russian Academy of Sciences . ...

Еще в разделе: (Показать все результаты (>29) - lcc.chem.msu.ru/ )

... Активные темы Список участников Поиск по форуму Помощь . ... Экологический Форум - Фундаментальная Экология : Предложения и замечания по сайту . Тема: Include Restaurant Forms And as well , Au . ... To be certain that quality dining skills through quality service, a lot of food establishments commit in a restaurant paging system. ... Переход на форум -- Выберите форум -- О сайте "Фундаментальная экология" - Предложения и замечания по сайту Научные семинары - Научные семинары . ...

Еще в разделе: (Показать все результаты (>6020) - www.sevin.ru/ )

• Экологический Форум - Фундаментальная Экология: includes a smaller sized head
• Экологический Форум - Фундаментальная Экология: includes a more compact head
• A.N. Severtsov Institute of Ecology and Evolution (IPEE RAS): News

Prediction of physical properties of materials based only on their chemical composition has long been an intriguing task. ... The main interests of Prof. Lebedev 's group are physical properties of crystals exhibiting structural instability, in which different phase transitions (including the ferroelectric one) can appear. ... A.I. Lebedev. ... Physics of the Solid State 51 , 362 (2009) ; e-print arXiv:1305.0240 (2013) ; [local copy] . ... Physics of the Solid State 51 , 2324 (2009) ; [local copy] . ...

Еще в разделе: (Показать все результаты (>109) - scon155.phys.msu.su/ )

• EXAFS studies of semiconductors and ferroelectrics
• Theory of electronic properties of disordered semiconductors and systems with
• Vladimir S. Dneprovskii