Databases (NSDC) of the Natural Planetary Satellites. ... NSDC: Database of astrometric observations of Natural Planetary Satellites . ... They are thoroughly looking for observations in different sources, creating their owndatabases which are then mostly inaccessible to other researchers. ... In the file "content" with explications, the reference is given to the data source as well as the bibliographic reference. ... Data sources. ... Why a specific bibliographic database for Natural satellites? ...

Еще в разделе: (Показать все результаты (>483) - lnfm1.sai.msu.ru/ )

• Scientific activity

... sepals and stamens - five petals fused at the base to form a tubular structure - found mainly along coastal limestone rocks Six flower color morphs have been observed - pink , yellow , yellow corolla with white calyx flowers, white, orange and ivory - pink and yellow morphs are the most frequent Distribution - Daito and Izu-Ogasawara Islands of Japan - Taiwan (offshore eastern region) - Ryukyu Archipelago Leapfrog ... Common haplotypes were not restricted to a certain flower...

Еще в разделе: (Показать все результаты (>292) - herba.msu.ru/ )

• http://herba.msu.ru/shipunov/school/biol_330/presentations/gymnosperms/gymnosperms.pdf
• Plant evolution on the small islands of the Russian White Sea
• Algologia. Vol.7, No. 3

... Criteria of branch quality . As it was repeatedly told , phylogenetic trees consist from branches. ... I. e., those positions, which can separate sequences of the branch from other sequences in the alignment. ... Measure of branch separation . ... Here and further: A - branch of the tree, i , j - sequences of alignment . ... That's why number of conserved positions in some branch should be considered in complex with the distribution of conserved positions in the whole alignment. ...

Еще в разделе: (Показать все результаты (>5493) - monkey.belozersky.msu.ru/ )

• About this project
• ETS species distribution

Haiqing Xu, Yu Gao, Hongqi Zhang, Takashi Sakurai, Masaoki Hagino, D. Sokoloff, A.Pevtsov, Magnetic helicity of solar active regions as revealed by vector magnetograms and coronal X-ray images, Publ. Astron. ... Japan, 64, 54, 12 pages, 2012. We have used photospheric vector magnetograms of 15 different solar active regions to calculate the current helicity parameter, ?av, and the linear force-free field (LFFF) parameter, ?best, that fits best the observed transverse field. ...

Еще в разделе: (Показать все результаты (>215) - srcc.msu.ru/ )

• D.Moss, R.Stepanov, T.G.Arshakian, R. Beck, M.Krause, D.Sokoloff, Multiscale
• Sokoloff D., Zhang H., Moss D., Kleeorin N., Kuzanyan K., Rogachevski I., Gao
• Arshakian T. G., Stepanov R., Beck R., Krause M., Sokoloff D. Simulations of

News . ... Archive of News . III Russian Scientific Conference with international participation ?The dynamics of modern ecosystems in the Holocene? First circular . ... We invite you to participate in the III rd Russian Scientific Conference with international participation, THE DYNAMICS OF MODERN ECOSYSTEMS IN THE HOLOCENE , which will be held from 12 to 15 March 2013 in Kazan at the base of Institute of Problems in Ecology and Mineral Wealth, Tatarstan Academy of Sciences. ...

Еще в разделе: (Показать все результаты (>5073) - www.sevin.ru/ )

• A.N. Severtsov Institute of Ecology and Evolution (IPEE RAS): News: News:
• A.N. Severtsov Institute of Ecology and Evolution (IPEE RAS): News: News: II
• A.N. Severtsov Institute of Ecology and Evolution (IPEE RAS): News: Archive of

... The Radon transform (also known as the Hough transform) is formulated as a family of line integrals through a two-dimensional function. ... The Radon transform provides us with a simple means of computing the FF plane of the autochirplet transform, by using the Wigner distribution, and arriving at a transform space that tells us basically the same information as the chirplet FF-plane, except that we benefit from the greater resolution of the Wigner distribution. ...

Еще в разделе: (Показать все результаты (>5095) - crydee.sai.msu.ru/ )

• Historical Notes
• ApSA courses
• Program of course

... Among them there is forward modeling for uniform anisotropic halfspace to calculate ARS diagrams for different arrays (AM (U), AMN (E), dipole equatorial (D), three-pole (T), Y and Arrow-type (AT) array, etc.), when source of current is on the earth surface or at a depth. All linear arrays (AM, AMN, dipole axial) give anisotropy ellipses with axis ratio equal to anisotropy coefficient, while non-linear arrays (D and others) have this ratio equal to anisotropy coefficient in the 5-th power. ...

Еще в разделе: (Показать все результаты (>79) - geophys.geol.msu.ru/ )

... Introduction . Up: One-Sided Communications Next: Initialization Previous: One-Sided Communications . Remote Memory Access ( RMA) extends the communication mechanisms of MPI by allowing one process to specify all communication parameters, both for the sending side and for the receiving side. This mode of communication facilitates the coding of some applications with dynamically changing data access patterns where the data distribution is fixed or slowly changing. ... Центры . ...

Еще в разделе: (Показать все результаты (>698) - www.parallel.ru/ )

• Extended Fortran Support | PARALLEL.RU - Информационно-аналитический центр по
• MPI_Allreduce | PARALLEL.RU - Информационно-аналитический центр по параллельным
• MPI_Reduce_scatter | PARALLEL.RU - Информационно-аналитический центр по

... CompHEP Models. ... CompHEP is based on an idea of the physical model. ComHEP Models are very simular to physical models in high energy physics, like Standards Model or MSSM. ... Two of them are versions of the Standard Model (SU(3)xSU(2)xU(1)) in the unitary and t'Hooft - Feynman gauges. ... Standard Model in Feynman gauge . ... This output can be written in LaTeX format and in the form of CompHEP model files, which allows one to start calculations of processes in the new physical model. ...

Еще в разделе: (Показать все результаты (>20) - comphep.sinp.msu.ru/ )

• extra:main [CompHEP]
• faq [CompHEP]

... About 70 scientific papers. The theory of square parachute is created, describing distribution of parameters of shape, tension and resistance to airflow of canopy in steady-state condition for various sets of suspension line lengths and air-permeability. ... The practical recommendations for optimal parachute application are submitted. ... It is discovered experimentally that a character of pressure distribution for a square canopy depends on a particular choice of suspension line lengths. ...

Еще в разделе: (Показать все результаты (>9) - margaret.imec.msu.ru/ )

• Pressure Distribution Peculiariry Along Square Canopy
• Air-Permeability Influence on Pressure Distribution Character
• On Square Parachute Differential Equations

Buffer phenomenon in mathematical mo dels of natural sciences Mishchenko E. F. Steklov Institute of Mathematics, Russian Academy of Science e-mail: mishch@mi.ras.ru Kolesov A. Yu. Demidov Yaroslavl State University e-mail: kolesov@uniyar.ac.ru Rozov N. Kh. ... 3] Kolesov A.Yu., Mishchenko E.F., and Rozov N.Kh., ... Math., ... 6] Kolesov A.Yu., and Rozov N.Kh., ... The Buffer Phenomenon in Combustion Theory", Dokl. ... 13] Mishchenko E.F., Sadovnichii V.A., Kolesov A.Yu., and Rozov N.Kh., ...

Еще в разделе: (Показать все результаты (>42) - pont2008.cmc.msu.ru/ )

• http://pont2008.cs.msu.ru/files/en/abstracts/Gamkrelidze.pdf
• Program Международная конференция Дифференциальные уравнения и топология ,

... Among the methods of theoretical investigation of coordination compounds, molecular mechanics seems to be an optimal choice. However, conventional MM force fields typically do lack metal-related force field parameters. ... Let us calculate (MM) energy gradient for experimental structures using purely organic force field with no metal-dependent terms. ... In other words, thus calculated forces give an "imprint" for the derivation of metal-dependent forces. ...

Еще в разделе: (Показать все результаты (>1031) - chem.msu.ru/ )

• Comparative Analysis of Intramolecular Parameters of Nitrocompounds:
• LABORATORY OF PHOTOCHEMISTRY
• Moscow University Chemistry Bulletin Vol. 54, No. 5, P. 278 (2013)

... SDPfox - the software package for the prediction of functional specificity groups and amino acid residues that determine the specificity using MPA. ... Amino acid residues that determine differences in protein functional specificity and account for correct recognition of interaction partners, are usually thought to correspond to those positions of a protein multiple alignment, where the distribution of amino acids is closely associated with grouping of proteins by specificity. ...

Еще в разделе: (Показать все результаты (>11) - bioinf.fbb.msu.ru/ )

• SDPsite - Algorithm Format requirements
• SDPpred

... Perturbation Theory has a long tradition. ... The stability of an equilibrium (or periodic) state of a system depends in the first instance on the eigenvalues of the system linearized about that state. ... After an introductory chapter on stability theory, a long Chapter 2 deals with bifurcation analysis of eigenvalues of matrices depending on several parameters: this is the core of the book on which most of the rest depends. ...

Еще в разделе: (Показать все результаты (>31) - mailybaev.imec.msu.ru/ )

• Multiparameter Stability Theory with Mechanical Applications
• Book review by Professor Teodor M. Atanackovic

Maximization of Sensitivity of the PH-Premium for Families of Pareto Distributed Risks / Irkhina N.A. // Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika. ...

Еще в разделе: (Показать все результаты (>273) - vestnik.math.msu.su/ )

• Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>13) - mouse.genebee.msu.ru/ )

... Online Services | ... Construct your query and output by sequental openings of needed fields. One output field must be selected (not be blank) at least. ... Query parameters: . Select for output . ... Energy (keV) . ... Y D H M S MS US NS PS FS AS EV KEV MEV or Stable . ... Energy of the ?-ray (keV) . ... Energy parameters of nucleus (B , Alpha energy, N, P separation energy) . ... Neutron separation energy (keV) . Proton separation energy (keV) . ... Excited energy(keV) . ...

Еще в разделе: (Показать все результаты (>35) - cdfe.sinp.msu.ru/ )

• CDFE => Online Services => Nucleus Ground State Parameters
• CDFE => Online services => Chart of nucleus shape and size parameters
• CDFE => Online Services => Calculator and Graph Engine for Atomic Nuclei

... DEVELOPMENT OF EXPLICIT CYCLIC SCHEMES . WITH CHEBYSHEV?S POLYNOMIALS FOR SPACE NEUTRON KINETICS . ... Questions have been studied to use effectively explicit schemes for solving spatial kinetics. ... Algorithms have been developed to solve spatial kinetic equations on the basis of explicit cyclic schemes with time varying steps designed by V.I. Lebedev [1] as well as schemes of local iterations proposed by O.V. Lokutsievskiy and V.O. Lokutsievskiy [2]. ... Code development. ...

Еще в разделе: (Показать все результаты (>167) - sp.cs.msu.ru/ )

• C-DVM language description
• DVM-system. Goals and structure
• Lib-DVM. Preliminary design

O. A. Chesnokova, E. Erten chesnokova@mfb-geo.com ANALYSIS ON THE RELATION BETWEEN STATISTICAL SIMILARITY MEASURES AND AGRICULTURAL PARAMETERS: A CASE STUDY Swiss Federal Institute of Technology ETH Zurich ABSTRACT Polarimetric Synthetic Aperture Radar (PolSAR) images are widely used for agricultural fields monitoring and change detection applications due to their all-weather acquisition possibilities and inherent properties including phase and amplitude information. ... Fig. ...

Еще в разделе: (Показать все результаты (>384) - www.geogr.msu.ru/ )

• CONTENTS ? 2 - 2012
• CONTENTS ?2 - 2011
• CONTENTS ? 6 - 2012

The Chair of Mathematical Theory of Intelligent Systems and . ... Research . ... Information Monitoring . ... Search in Databases . ... It is possible this apparatus in an applied investigations on recognition of consecutive information. ... Investigation of possibility of using the additional (non-acoustic) sources of information for speech recognition. ... Investigations of possibilities of usage of methods of fussy logic, optimal control and others in solving of problems of speech recognition. ...

Еще в разделе: (Показать все результаты (>129) - www.intsys.msu.ru/ )

• Intelligent Systems :: Research :: :: Articles
• Интеллектуальные системы :: Сотрудники :: Гасанов Эльяр Эльдарович :: Instantly
• Options