... Однако, для человека, который бывал на этом сервере раньше, многие из этих кусков покажутся весьма родными и близкими. ... Старые новости сервера . История нашего сервера . Впечатления и репортажи . ... Новости за первую половину 2000 года здесь . Новости за осень 1999 года здесь . Новости за май-июнь 1999 года здесь . Новости за март-апрель 1999 года здесь . ... Впечатления о Дне ВМК '99 by Slayer . ... Студенческий сервер "Мы из МГУ" был создан весной 1999 года. ...
... Geography of World Economy . ... Departments . About Faculty . ... Field stations . ... Type of field courses . ... Department of Geography of World Economy . Department of Landscape Geochemistry and Soil Geography . ... Department of Oceanology . ... Department of Social-Economic Geography of Foreign Countries . ... In particular, the Dean of the Faculty and the Heads of Departments have a direct responsibility for the efficient running of academic departments. ... DEPUTY DEAN FOR RESEARCH . ...
... Three representative parameters characterizing the solar activity are sunspot number (W), 10.7cm radio solar flux (F10.7) and mean solar magnetic field value (SF). ... Practically persistent time series of these parameters are appropriate data sets for modelling and forecasting by means of Artificial Neural Networks (ANN). Methods of optimization of ANN input data sets and selection of training, testing and examination sets are discussed in the paper. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Stanley Milgram SIX DEGREES OF SEPARATION OR SMALL WORLD PHENOMENON 1998, Small world networks Steven Strogatz Duncan Watts Laszlo Barabasi and Reka Albert 1999 In 1999 American physicits Barabasi and Albert have shown that distribution of nodes by the number of links in tke most real networks is described by power law and they called such networks as scale-free networks Reprinted from Linked: The New Science of Networks by Albert-Laszlo ... Human disease network. ... disease , ). ...
[
Текст
]
Ссылки http://www.soc-phys.chem.msu.ru/rus/prev/zas-2015-12-01/presentation.pdf -- 1351.3 Кб -- 25.12.2015 Похожие документы
... 29 мая 2008 г. в фойе КЦ МГУ прошел концерт Вокального класса КЦ МГУ, представившего новую программу "Арии, романсы русских и зарубежных композиторов" в исполнении студентов, аспирантов, преподавателей и выпускников МГУ. ... Полную версию программы концерта можно посмотреть здесь. 25 мая 2007 г. в фойе КЦ МГУ прошел концерт Вокального класса КЦ МГУ, представившего новую концертную программу. ... Начало концерта в 19.00 в фойе КЦ МГУ . ... Вокальный класс КЦ МГУ . ... Вокальные События в КЦ МГУ . ...
... Sov.Phys.-Plasma Phys.) 1978.V.4. ... Timofeev I.B., Bychkov V.L. Influence of ionizing processes on the lifetime of plasma ball in air. ... Bychkov V.L. Database on ball Lightning for PC. ... Bychkov V.L., Bychkov A.V., Stadnik S.A. Polymer Fire Balls in Discharge Plasma. ... Emelin S.E., Bychkov V.L., Astafiev A.M., Kovshik A.P., Pirozerski A.L. Role of discharge products throttling for generation of ball lightning with a condensed core from a high pressure vapor - gas phase Proc. 11-th Intern. ...
... 1996. ... Contents . CONTENTS . ... Would Russia rise again? ... Alenaces to Russia's security . ... and the 'Helms - Burton' bill . ... and certain problems of the internal mission . Parlamentarism in Russia and abroad . ... of constitutionalism in Russia. ... Bills and legislative proposals. ... How to change the Constitution - on the . constitutive revision and amendements to the Constitution . ... Certain aspects of the federal bill on the minimum . ... in Oktober-November 1996 . ...
MOSCOW STATE UNIVERSITY The Scientific Society of students of the Law Faculty January 25, 2014 1- The flyer of the Unit `Jurisprudence' of International scientific conference "Lomonosov - 2014" 1. ... The organizers of the Unit are the law faculty of Moscow State University and the Scientific Society of students of the law faculty. ... Administrative law 2. ... The Organizing Committee: Presiding Officer Kozlova Natalya Vladimirovna (Deputy Dean of Law Faculty on study, Doctor in Law, Professor). ...
[
Текст
]
Ссылки http://law.msu.ru/bitcache/bc6ca81fd934d7083472270ea392667daf49eebb?vid=30191&disposition=attachment&op=download -- 260.2 Кб -- 28.02.2014 Похожие документы
? ? 1.???????????????? 3 2.Реформа и инновации в сфере государственных услуг в России. 8 3.Особенности развития экономики Шэньчжэня 26 4.в условиях модификации модели роста в КНР 26 5.???????????????? 39 6.СРАВНИТЕЛЬНЫЙ ОПЫТ УЧАСТИЯ РОССИИ И КИТАЯ В ИНСТИТУТАХ ГЛОБАЛЬНОГО УПРАВЛЕНИЯ 41 7.Принципы развития межрегиональных центров подготовки кадров для государственного управления в Российской Федерации 59 8.??????????????? 74 9.Региональные особенности государственного регулирования сферы образования в РФ 82
... О кафедре . ... Опубликовано avst в Март 13, 2016 - 20:27. ... Заседание спецсеминаров "Искусственный интеллект" и "Парадигмы программирования" 15 марта 2016 г. будет совместным и пройдет (как обычно, в 18:00) в ауд. 526-б . ... В прикрепленном файле ответы на 2 вариант экзамена по курсу "Языки программирования" . ... Опубликовано avst в Декабрь 21, 2015 - 21:03. ... 2 поток - в 10.00, ауд. ... к.ф.-м.н. Математический спецкурс кафедры алгоритмических языков . ... кафедра АЯ ВМК МГУ, 2009 2014 . ...
... President George W. Bush Department of Education Strategic Goals: Goal One: Create a Culture of Achievement Create a culture of achievement by effectively implementing the president's plan, No Child Left Behind, and by basing all federal education programs on its principles: accountability, flexibility, expanded parental options, and doing what works. ... Goal Six: Establish Management Excellence Create a culture of accountability throughout the Department of Education. ... accountability | ... line...
... Публикации . ... 1, 012506 DOI . ... 1, 012509 DOI . ... 1, 103598 DOI . ... Edge field emission of large-area single layer graphene Kleshch V.I., Bandurin D.A., Orekhov A.S., Purcell S.T., Obraztsov A.N. Applied Surface Science, Elsevier BV (Netherlands) DOI . ... Graphene Formation on Surfaces of Single Crystal Metals Shvets P.V., Soon J.M., Verger A., Obraztsov A.N Journal of Nanoelectronics and Optoelectronics, American Scientific Publishers (United States) DOI . ... Материалы, ? ...
... For impatient users: You can download RusTeX in three different ways (Full installation; Selective download; Diskette-ready minimal installation) --- so at least read explanations about these methods before you download something. Please, use "Save link as" (right mouse button) for downloading files, otherwise .arj files and other binary files will be corrupted. ... TeX files are compact and readable in any text viewer: just text and commands for formatting and commands for equations drawing. ...
... В лабораторных работах с использованием программной модели WPF надо создать пользовательский интерфейс для работы с данными классов из лабораторных работ предыдущего семестра. ... Элементы XML. ... Синтаксис элемент-свойство для коллекций. ... Класс ItemsControl - базовый класс элементов управления для работы с коллекцией. ... Классы архитектуры элемента управления DataGrid в WPF. ... Создание пользовательского интерфейса приложения с использованием классов WPF для классических элементов управления....
[
Текст
]
Ссылки http://lmph.cs.msu.su/Lekcii_files/UI_Prog.doc -- 79.5 Кб -- 16.11.2011
[
Текст
]
Ссылки http://lmph.cmc.msu.ru/Lekcii_files/UI_Prog.doc -- 79.5 Кб -- 16.11.2011 Похожие документы
... 1997-2000 ) - (0-117) , .. 2001 . ... a. ppa . ... a (a paa), pa . ... 1999 "" - . ... 1 31 1997 , , 1 1998 , . ... p a pa a apa pa; ! ... a, ap aa a a ppa paa apa a p p p p a paa P. - . ... 5 2000/2001 317 9.00-10.35 12.40-14.15 .. ... p pp apap p p pa. 2. paa ppa ppa · Ppa ppa ap pa a p pap. · paa pa ppa pa ap ppa paa paa pap. · pp pa ppa AREN (pa pp a, R-apa, p p apa). · a pa a pa p p (a pa ppa, ). ... 100 80 60 40 20 0 1997 1998 1999 2000 38 100 80 60 40 20 0 1997 1998 1999 2000 , 250 , . ...
... Новости . ... Главная Новости Работа . Работа для программистов, инженеров, химиков (C++, Java, Linux, MPEG, FPGA, CDMA, LCD, TFT, OLED) . ... Средний балл: выше 4,0 Для подачи заявки необходимо составить на английском языке развернутое резюме (личные данные, образование, опыт работы) и направить его до 1 октября 2005 года по адресу: Rabota@samsung.ru . Более подробная информация и подача заявки: http://Rabota.samsung.ru . ... Новости сайта . ... Работа . ...
... О факультете | ... Структура факультета . ... Международный форум Медиа Будущего , в котором примут участие ведущие профессионалы мировых СМИ и авторитетные аналитики, пройдет 27 июня на площадке пресс-центра РИА 'Новости'. ... Сайт форума 'Медиа Будущего': http://fmf.rian.ru/ . ... Виталий Третьяков считает, что телевидение должно иметь 'книжный фундамент', то есть опираться на традиционные культурные ценности человечества.. ... 2009-2014 Высшая школа телевидения МГУ им. М.В.Ломоносова . ...
... Coordination of economic policies and convergence of economic performance are fundamental to the integration of national economies in the Community. ... When U.S. President Barack Obama enters his White House meeting with Israeli Prime Minister Benjamin Netanyahu on March 5 -- angling to dissuade Israel from attacking Iran's nuclear facilities -- there will be one seemingly mundane issue on his mind that he may be too uncomfortable to share with his guest: gasoline prices. ... 2004. ...