... Mathematical Treatment of Exhaust Systems with Acoustic Properties Using Mathlie I. Algorithms . ... The first part of the two talks is concerned with algorithms applied to examples origin from an exhaust system. ... The model equations are determined by conservation of mass, momentum and energy. In addition there exists an equation of state for the ideal gas system. ... Applying computer algebra to these model equations, we demonstrate that solutions can be derived. ...
... UHECR SINP MSU . ... News . ... TUS Ultra high energy cosmic ray detector on-board the Lomonosov satellite . ... According to existing estimations it can be a prominent source of ultra high energy cosmic rays (UHECR). ... In either case, the newly born magnetar is an attractive site for producing ultrahigh-energy cosmic rays (particles with individual energies exceeding 10 18 e V ; UHECRs). ... A new mechanism for the acceleration of ultra high energy cosmic rays (UHECR) is presented here. ...
... Carbon and Nitrogen As Resources Limiting the Growth of Mono- and Mixed Cultures of Pseudomonas aeruginosa Dissociants P. V. Fursovaa, E. S. Mil'kob, and A. P. Levichc c Department of Biophysics Department of Microbiology Department of General Ecology, Moscow State University, Moscow, 119991 Russia e-mail: fursova @biophys.msu.ru b a Received December 26, 2006 Abstract--New experiments for detection of resources limiting the ... 1997; Levich, 2000). ... 1) (Levich et al., ...
... Факультет . ... Истории России до начала XI.. ... Подразделения факультета . ... Истории России до начала XIX века . Истории России XIX - начала XX.. Отечественной истории XX-XXI вв . ... Истории Церкви . Истории общественных движений .. Новой и новейшей истории стран.. ... Исторической информатики . Истории древнего мира . ... Философский ф-т . ... Ф-т государственного управления . ... Администратор АСУ УП: Трубников Ю.В. 2014 Исторический факультет МГУ им. М.В.Ломоносова. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
To use Microsoft Outlook Web access, browser settings must allow scripts to run. ... If your browser does not support scripts, you can download Microsoft Internet Explorer for access to Outlook Web Access. ... Select this option if you use Outlook Web Access on a public computer. ... This is a private computer . ... Use Outlook Web Access Light . ... Type the address for Outlook Web Access into the field, click Allow, and then click OK to save your changes. Connected to Microsoft Exchange . ...
Lessons learned from the Thirty Meter Telescope site testing Tony Travouillon Sebastian Els, Angel Otarola, Reed Riddle, Matthias Schoeck, Warren Skidmore TMT.XXX.PRE.05.0XX.DRF01 1 Introduction TMT and its Site testing. Important choice before going on site. ... Considerations during analysis of the data. TMT.XXX.PRE.05.0XX.DRF01 2 Some Background about the TMT Site Testing TMT is a 30m, segmented, RitcheyChretien telescope design. ... ASCA Cloud Cover Analysis So how do we do it in practice? ...
[
Текст
]
Ссылки http://site2010.sai.msu.ru/static/doc/TTravouillon_TMT_site_testing_site2010.pdf -- 2354.3 Кб -- 18.10.2010 Похожие документы
Информационное письмо БФ-01 (23.01.96) О начале финанстрования РФФИ и начале реализации проекта БАФИЗ-96 (РФФИ номер 95-07-19502). ... В связи с этим, 16 января 1996 года мы провели совещание с частью основных исполнителей из институтов-участников проекта БАФИЗ-96. Приглашения по e-mail были направлены во все семь институтов- участников проекта: ОИЯИ, НИИЯФ МГУ, ИФВЭ, ИТЭФ, ИЯИ, ПИЯФ, ИЯФ СОРАН. ... 8) Хранение и обеспечение эффективного поиска в полнотекстовых и гипертекстовых базах данных. ...
... Продолжалась обработка данных эксперимента ZEUS на коллайдере HERA. ... By D0 Collaboration [arXiv:1011.1931] FERMILAB-PUB-10-446-E (Nov 2010) 10p. 2) A measurement of the ratio of inclusive cross sections $\sigma(p\bar{p}\rightarrow Z+b{\rm\, jet})/ \sigma(p\bar{p}\rightarrow Z+{\rm jet})$ at $\sqrt{s}=1.96$ TeV. ... ZEUS Collaboration (S. Chekanov et al.) ... By CMS Collaboration [arXiv:1010.4439] CMS-EXO-10-002 (Oct 2010) 3) Search for Dijet Resonances in 7 TeV pp Collisions at CMS. ...
... РЕГЛАМЕНТ проведения Универсиады «Ломоносов» по международным отношениям в 2015/2016 учебном году 1. ... с 00:00 часов 02 марта 2016 года до 23:59 часов 30 марта 2016 года - проведение отборочного этапа; . с 01 апреля 2016 года по 10 апреля 2016 года - проверка работ участников, публикация на портале Универсиады результатов проверки, проведение апелляций, определение победителей и призеров отборочного этапа, публикация на портале списков победителей и призеров отборочного этапа. ...
[
Текст
]
Ссылки http://fmp.msu.ru/attachments/article/356/UNIVERSIADA_REGLAMENT.doc -- 53.0 Кб -- 22.01.2016 Похожие документы
... Объявлены победители и лауреаты конкурса. ... Научно-исследовательский вычислительный центр МГУ им. М. В. Ломоносова, Институт программных систем РАН, корпорация Sun Microsystems, компания "Т-Платформы" и корпорация AMD объявляют конкурс на лучший проект использования высокопроизводительного кластерного решения среди образовательных и научных организаций России, Украины и Белоруссии. К рассмотрению принимаются идеи проектов, не реализованных на момент проведения конкурса. ...
Рабочая программы дисциплины 1. Оптика композитных сред. ... Рассматриваются основные модели и приближения, применяемые для описания эффективного отклика композитных сред. ... Изучение основ статистического описания локальных полей в случайно- неоднородных средах. ... Общая трудоемкость, акад. часов |. ... Лабораторные работы, акад. часов |. Самостоятельная работа, акад. часов |. ... рассеяние |Функция Грина | ... поле излучения | ... Какие приближения используются при выводе формулы Гарнетта? ...
[
Текст
]
Ссылки http://quantum.phys.msu.ru/sites/default/files/downloads/122/optika-kompozitnyh-sred.doc -- 138.5 Кб Похожие документы
European Research Council ERC Grant Schemes Guide for Applicants for the Starting Grant 2012 Call Version 14/07/2011 The Guide is published by the ERC Scientific Council on http://erc.europa.eu It can also be downloaded from the Research & Innovation Participant Portal on http://ec.europa.eu/research/participants/portal/ and CORDIS page on http://cordis.europa.eu EUROPEAN COMMISSION FP7 Specific Programme IDEAS 1 IMPORTANT NOTICE Following the experience with previous calls, some adjustments and
... When embedded within a base document, a URL in its absolute form may contain a great deal of information which is already known from the context of that base document's retrieval, including the scheme, network location, and parts of the url-path. ... Introduction This document describes the syntax and semantics for "relative" Uniform Resource Locators (relative URLs): a compact representation of the location of a resource relative to an absolute base URL. ... 3.1) Base URL embedded in the | ...
... GOES corrected results are wrong, because the publication Smart D.F. and M.A. Shea, Comment on the use of GOES solar proton data and spectra in solar dose calculations, Radiation Measurements 30 (1999) 327-335 was erroneous (see "The issues...." above. ... The criticism of the use of the log-normal distribution for the data fit in Feynman et al. is excessive. Indeed, Feynman et al. use only the high intensity part for the fit making the results almost independent of the low energy part. ...
МОСКОВСКИЙ ГОСУДАРСТВЕННЫЙ УНИВЕРСИТЕТ им. М.В. ЛОМОНОСОВА Механикоматематический факультет На правах рукописи Беляков Антон Олегович Определение моментов инерции крупногабаритных тел по колебаниям в упругом подвесе 01.02.01 теоретическая механика Диссертация на соискание ученой степени кандидата физикоматематических наук Научный руководитель доктор физикоматематических наук А.П. Сейранян Москва 2005 г. Содержание Введение Глава I. Описание метода измерений 1 Существующие методы измерения моментов инерции 2
... 1997-2000 ) - (0-117) , .. 2001 . ... a. ppa . ... a (a paa), pa . ... 1999 "" - . ... 1 31 1997 , , 1 1998 , . ... p a pa a apa pa; ! ... a, ap aa a a ppa paa apa a p p p p a paa P. - . ... 5 2000/2001 317 9.00-10.35 12.40-14.15 .. ... p pp apap p p pa. 2. paa ppa ppa · Ppa ppa ap pa a p pap. · paa pa ppa pa ap ppa paa paa pap. · pp pa ppa AREN (pa pp a, R-apa, p p apa). · a pa a pa p p (a pa ppa, ). ... 100 80 60 40 20 0 1997 1998 1999 2000 38 100 80 60 40 20 0 1997 1998 1999 2000 , 250 , . ...