... Так же доступен набор вычислительных задач. ... Через вкладку "Запуск тестовых задач" пользователь может запускать тестовые задачи на СКИФ МГУ "ЧЕБЫШЕВ". ... Результаты выполнения задач просматриваются во вкладке "Система визуализации и анализа результатов" или по ссылке http://www.polygon.parallel.ru/visualization.php . Пользователю надо выбрать нужную задачу, компилятор, оцпию компиляции и платформу. ... Располагается по адресу www.polygon.parallel.ru/bourne/compilers.php . ...
... Geography of World Economy . ... Physical Geography and Landscape Science . ... About Faculty . ... Field stations . Faculty branches . ... Type of field courses . ... Among them there are: 2 Full Member and 4 Corresponding Members of Russian Academy of Sciences, distinguished scientists, laureates of State and Government Prizes of USSR and Russia in the field of education, science and technology, laureates of the Lomonosov and Anuchin Prizes and many more. ... Geografia [Moscow University Herald. ...
... BK_Sections . Выберите представление . Все элементы . ... Изменить настройки и столбцы . ... Изменить в таблице данных . ... Элементы теории формальных языков и грамматик. ... Основы программирования. ... Операционные системы. ... Низкоуровневое программирование. ... Императивное программирование. ... Функциональное программирование. ... Объектно-ориентированное программирование. ... Языки программирования. ... Компьютерная графика и визуализация. ... Теоретическое программирование. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
-- MySQL dump 8.23 -- -- Host: localhost Database: slides --------------------------------------------------------- -- Server version 3.23.58 -- -- Table structure for table `book` -- DROP TABLE IF EXISTS book; CREATE TABLE book ( id_content int(11) NOT NULL default '0', title varchar(255) default NULL, text1 text, text2 text, PRIMARY KEY (id_content) ) TYPE=MyISAM; -- -- Dumping data for table `book` -- INSERT INTO book VALUES (110,'Электронный учебник','',''); INSERT INTO book VALUES
... Skobeltsyn Institute of Nuclear Physics, Lomonosov Moscow State University, Moscow 119991, Russia. ... 6 C r o s s s e c tio n ( 1 0 In the present study the animated crossed electron -ion beams method [1] is applied for measurement of absolute cross sections for electron impact single and multiple ionization of C+, N+ and O+ ions at incident electron energy values up to 2.5 keV. 6 6 (a) C 2+ (b) N 2+ cm ) 2 - 17 4 4 2 2 0 10 6 100 1000 0 10 100 ...
Форум кафедры биофизики биологического факультета МГУ им. М.В.Ломоносова . ... Список разделов ? Рабочие семинары ? Общекафедральный семинар . ... Ответов . Просмотров . ... styx 21 окт 2000 03:01 . ... 36424 Просмотров . ... 641 Просмотров . ... 334 Просмотров . ... Семинар 19 ноября 2012 . ... Показать темы за: Все темы 1 день 7 дней 2 недели 1 месяц 3 месяца 6 месяцев 1 год Сортировать по: Автор Время размещения Ответов Заголовок Просмотров по возрастанию по убыванию . ...
... ЭФФЕКТ КПН В -СИСТЕМЕ В простейшей трехуровневой системе атомных переходов в -конфигурации два нижних долгожи вущих уровня j1i и j2i с частотным расщеплени ем связаны с верхним возбужденным энергетиче ским уровнем j3i двумя световыми полями (рис. ... Особенностью спектров поглощения в попереч ном магнитном поле является расщепленная линия резонанса КПН, величина расщепления которого совпадает с величиной зеемановского расщепления подуровней j2i и j4i уровня J = 1: ! = 2 0 (см. ...
[
Текст
]
Ссылки http://qilab.phys.msu.ru/papers/jetp-123(4)-2003-reprint-ru.ps -- 2174.5 Кб -- 04.02.2008 Похожие документы
Estimations of dome seeng by results of optics quality tests with Shack-Hartman wavefront sensor. ... Measurements on AZT-22 Telescope diameter: 1000 mm F/7.7 Effective subaperture: 37.5 mm Exposure time: 100 ms Time between exposures: 5 s Individual image with tilts in X direction AZT-22 tower The spatial spectrum evolution (top) and wind direction in measurements processes . AZT-22. ... ZTSH dome Zeiss-1000 dome The spatial spectrum evolution (up) end wind direction through time. ...
[
Текст
]
Ссылки http://site2010.sai.msu.ru/static/doc/SPotanin_site2010.pdf -- 522.6 Кб -- 31.10.2010 Похожие документы
. Attached is the discovery image of SN1999by. It is a 30 second exposure with the 30cm SCT and Starlight Xpress camera. The discovery was confirmed by Tom Boles and Mark Armstrong and looks as if it could be very bright. Although the weather has been very poor, I have managed over 1500 observations in April. Ron Arbour . Back to Bright Supernovae . David Bishop Last modified: Mon May 3 09:08:05 EDT 1999
... The kinetics of the ESR signal from P700 (ESR signal I) was recorded at different concentrations of exogenous ferredoxin, ,A kinetic model was developed for ferredoxin-dependent cyclic electron transport around photosystem I. A multiparticle model was built to directly describe electron transfer in multienzyme complexes and restricted diffusion of mobile carriers in individual compartments (stroma, lumen, intramembrane space) of the system. ... Ferredoxin Lumen Photosystem I Plastocyanin Fig. ...
Замораживание клеток . ... Снять клетки Трипсин-Версеном. ... Добавить среды и перенести взвесь клеток в центрифужную пробирку. ... Центрифугировать 5' при 1000-3000 об/сек . ... Снять надосадок, долить среды и ресуспендировать . ... Снять надосадок и долить {сыворотка-DMSO} 9:1 . ... 70њС, на ночь (не более 2суток) . ... Перенести в жидкий азот . ... Обычно 1 матрасик с маленькими клетками идет на 1 ампулу для замораживания . и 2 матрасика с большими - на 1 ампулу . ...
... Лаборатория космических лучей . ... ТУС" на борту МКА "Ломоносов" . ... НИР "ТАЯ" . КЛПВЭ" . Новости . Новости КЛПВЭ . ... Новости лаборатории . ... ТУС" на борту МКА "Ломоносов" Детектор космических лучей предельно высоких энергий на борту спутника "Ломоносов" . ... КЛПВЭ" Детектор космических лучей предельно высоких энергий на борту Международной космической станции . Детектор "ТУС предназначен для регистрации космических лучей предельно высоких энергий (в области 10 20 эВ). ...
... АЛГОРИТМЫ, предназначенные для обработки изображений целесообразно писать на С++, с широким использованием шаблонов и методов метапрограммирования. ... Пикселей много, и понятно, что здесь необходимо задумываться об эффективности кода, даже не потому, чтобы добиться максимального быстродействия, а потому, что просто иначе программу нельзя будет нормально отлаживать (пусть например время обработки изображения больше часа, сколько потребуется потратить времени, чтобы найти ошибку?) ...
Next] [Previous] [Top] [Contents] [Index] [netCDF Home Page] [Unidata Home Page] . ... The Unidata Program Center has developed a units library to convert between formatted and binary forms of units specifications and perform unit algebra on the binary form. Though the units library is self-contained and there is no dependency between it and the netCDF library, it is nevertheless useful in writing generic netCDF programs and we suggest you obtain it. ... Celsius . ... nit (unit of photometry) . ...
... For HP-UX 9.X: Upgrade to 10.20 . For HP-UX 10.[ 00|01|10]: Upgrade to 10.20 . ... This will allow you to configure the size of the TCP connection lookup hash table. ... If folks are running Apache on a PA-8000 based system, they should consider "chatr'ing" the Apache executable to have a large page size. ... The change can be validated by running Glance and examining the memory regions of the server(s) to make sure that they show a non-trivial fraction of the text segment being locked. ...
... A member of the Russian Academy ofsciences, a great physicochemist,and a world-renowned Professor Boris Vladimirovich Derjaguin died on May scientist, he laid the foundation of the modern science of colloids and surfaces. ... B. V. Derjaguin became known world-wide in scientific circles for his work on the stability of colloids and thin films of liquids which is now known as the DLVO theory, after the initials of its authors: Derjaguin, Landau, Verwey, and Overbeek. ...