Open Conference Systems . Conference Help . ... All Authors Title Abstract Index terms Full Text . ... Call for Papers (March 1, 2016 - June 1, 2016) . ... By Conference . ... It is incumbent on the authors to obtain appropriate approval to present their work to this international forum. 35-word Abstract : Your abstract should be a brief summary of your paper topic. If your paper is accepted, your 35-word abstract will be included in the Conference Program and the Technical Digest on CD-ROM . ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
A.A. Mailybaev and A.P. Seyranian , . Multiparameter Stability Problems. Theory and Applications in Mechanics , . ... A.P. Seyranian and I. Elishakoff , eds. Modern Problems of Structural Stability , . ... Structural Optimization under Stability and Vibration Constraints , . ... Stability and Catastrophes of Vibrating Systems Depending on Parameters . ... Evan- Ivanowski R.M., eds ), 1993, DE- Vol . ... Optimization. ... System optimization by oscillation and stability criteria . ...
... 000, 112 (2009) Printed 11 February 2010 A (MN L TEX style file v2.2) Analytical approximations of K -corrections in optical and near-infrared bands I1gor V. Chilingarian1 2 ,2,3 , Anne-Laure Melchior 1,4 and Ivan Yu. ... Received 2010 February 01; in original form 2009 August 14 ABSTRACT To compare photometric properties of galaxies at different redshifts, the fluxes need to be corrected for the changes of effective rest-frame wavelengths of filter bandpasses, called K -corrections. ... Table 1. ...
О.А. Казакевич ЯЗЫК И ФОЛЬКЛОР СЕВЕРНЫХ СЕЛЬКУПОВ И ИХ СОСЕДЕЙ ЧЕРЕЗ 165 ЛЕТ ПОСЛЕ СИБИРСКОГО ПУТЕШЕСТВИЯ М.А. КАСТРЕНА[1] Сибирское путешествие М.А. Кастрена стало настоящим прорывом в исследовании многих языков сибирских народов, прежде всего угорских и самодийских, но не в меньшей мере енисейских и алтайских. ... Во времена Кастрена, насколько можно судить по его путевым заметкам, знание русского языка среди южных селькупов, особенно среди тех из них, кто жил на Оби, не было редкостью. ...
[
Текст
]
Ссылки http://siberian-lang.srcc.msu.ru/sites/default/files/eventsfiles/kazakevich_article_abakan.doc -- 57.0 Кб -- 18.11.2013
[
Текст
]
Ссылки http://minlang.srcc.msu.ru/sites/default/files/eventsfiles/kazakevich_article_abakan.doc -- 57.0 Кб -- 18.11.2013 Похожие документы
GSK-3 Inhibitors: The Dataset . ... We suppose that it will be useful for the other researchers in the field of chemoinformatics; the main peculiarity of this Dataset is wide activity range of compounds and significant diversity of the actives (true inhibitors). ... IC50 is given in nM (sic!) according to the data reported in the article. It's a text field (as well as the other raw activity data fields) and values like '>10000' are given for inactive compounds. ...
LOCAL TSUNAMI WARNING AND MITIGATION ________________________________________________________________________________________________________________________________________ NON-LINEAR MECHANISM OF TSUNAMI GENERATION IN A COMPRESSIBLE OCEAN Mikhail A. Nosov, Sergey V. Kolesov M. V. Lomonosov Moscow State University, Faculty of Physics, Moscow, Russia E-mail: nosov@phys.msu.su ANNOTATION A nonlinear mechanism of long gravitational wave generation by ...
b e d e v P h y s i c a l I n s t i t u t e o f R A S , M o s c ow 1 27 April, 2012 A l e x a n d e r C h e s n o ko v , M axim Pavlo v (1 L avren t'en tndtico m po fsiH od ro p pno ach s, S ib erian D ivisio n o f R A S , prio,vo si1 2rsk ; 2 S ector o f m o m v I s e t u t e o t i y n a d y r a m ic e 27 A N l 20 bi 1 / 19 Vlasov (Collisionless Boltzmann) Kinetic Equation t ...
... VAR. Определение. ... Линейная и квадратичная модель VAR. ... Применение биномиального дерева к оценке стоимости американского put опциона и греков. ... Моделирование цен опционов методом Монте-Карло. ... Экзотические опционы. ... Формулы для цен опционов знать не обязательно. ... Модели поведения цен акций. ... Модель Блэка. Опционы на бонд, капы, опционы на своп. ... Цена европейского опциона на облигацию в этой модели. ... Цена европейского опциона на бескупонную облигацию в этой модели. ...
Global modeling of the magnetosphere in terms of paraboloid model of magnetospheric magnetic field I. Alexeev, V. Kalegaev The solar wind influence on the magnetospheric state is sufficiently nonlinear especially during strong disturbances. ... Model parameters are calculated through the empirical data. ... The solar wind driving of the magnetospheric magnetic field is realized through the dependence of the model parameters on empirical data (solar wind plasma parameters, IMF, AL and Dst). ...
... THE TIME HAS COME FOR "THUNDER BOOKS" . ... You may have forgotten what a thunder book is, or maybe you didn't ever use that name. ... It is a handy reference to those things you need to know about soils and how they behave. ... Well, if you knew how to use them as pages in a thunder book it would surely be a good start, but you need something uniquely yours. ... It has always been my belief that the mission of a soil survey is to help people understand and wisely use soil resources. ... Good read. ...
Gamma-quanta from SNRs V.N.Zirakashvili Pushkov Institute of Terrestrial Magnetism, Ionosphere and Radiowave Propagation, Russian Academy of Sciences (IZMIRAN), 142190 Troitsk, Moscow Region, Russia Outline · Acceleration of particles at forward and reverse shocks in SNRs · Amplification of magnetic fields · Modeling of broad-band emission · Radioactivity and electron acceleration Diffusive Shock ... 2010) . ... Cosmic ray positrons can be accelerated at reverse shocks of SNRs. ...
THOMSON ELECTRON X-RAY SOURCE FOR MEDICAL APPLICATIONS E.G. BESSONOV1, R.M. FESHCHENKO1*, M.V. GORBUNKOV1, V.I. SHVEDUNOV2 and A.V. VINOGRADOV1 1 2 P.N. Lebedev Physical Institute, 119991 Russia, Moscow Leninskii Prospect 53 Nuclear Physics Institute of Moscow State University, 119899 Russia, Moscow, Vorobyevy Gory Abstract A source of medical x-rays based on a 50 Mev storage ring and a quasi-continues picosecond laser is considered. ... Then the storage ring emittance is 0.1 mmmrad. ...
... site navigation | footer (site information) . IChO-2007 Participation Problems IChO RUSSIA Sponsors search . ... Moscow-1996 | ... Chemistry Department | ... Homepages of National Competitions Other International Science Olympiads Previous IChO's Miscellaneous Chemistry sites . ... Some fresh information is available. A letter from the President of 39th IChO . ... Information about post-Olympiad tour is now available . ... Information about guides of 39th IChO is now available. ...
30 TH I NT E R N AT I ON AL C OSMIC R AY C O N F ER EN C E Search for global asymmetry of UHECR arrival directions with the TUS space detector P. K LI M OV 1 ,O. K AL ASHE V 2 , B . ... Introduction Space-based ultra-high-energy cosmic-ray detectors such as TUS or JEM/EUSO are best suited for searches of the global anisotropies in the distribution of arrival directions of cosmic-ray particles because they provide full-sky coverage with a single experiment. ... Phys. 12, 25 (1999). ... Phys. Lett. ...
[
Текст
]
Ссылки http://cosrad.sinp.msu.ru/experiments/tus/doc/global2007.pdf -- 136.8 Кб -- 19.03.2008 Похожие документы