... First is by declaring two variables # $SOURCE and $ALTERNATIVES where $SOURCE is the symlink to be created and # $ALTERNATIVES is a list of alternatives. Second way is the use the function # alternatives_makesym() like the example below. EXAMPLE: # pkg_postinst() { # alternatives_makesym "/usr/bin/python" "/usr/bin/python2.3" "/usr/bin/python2.2" # } # # The above example will create a symlink at /usr/bin/python to either # /usr/bin/python2.3 or /usr/bin/python2.2. ...

Еще в разделе: (Показать все результаты (>19040) - mirror.msu.net/ )

• http://mirror.msu.net/pub/gentoo-portage/dev-java/jboss-marshalling/jboss-marshalling-1.3.0.ebuild
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/pdfrfc/rfc4223.txt.pdf
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc4223.txt

VIII Mendeleev Congress on General and Applied Chemistry , Moscow , 2007 2489 DESIGN OF GREEN CHEMICALS AND BIOMATERIALS WITH TAILORED PROPERTIES BASED ON HUMIC SUBSTANCES Perminova I.V., Karpiouk L.A., Ponomarenko S.A.b, Kovalenko A.N., Shcherbina N.S.a, Bolkova A.N., Kulikova N.A.c, Tsvetkova E.A.d, Muzafarov A.M.b, Petrosyan V.S.a Department of Chemistry , Lomonosov Moscow State University, Moscow 119992, ... The Path Forward for Biofuels and Biomaterials. ...

Еще в разделе: (Показать все результаты (>191) - mgumus.chem.msu.ru/ )

• http://www.mgumus.chem.msu.ru/publication/2010/2010-kazachkov-optimization.pdf
• http://www.mgumus.chem.msu.ru/publication/2006/2006-perminova-synthesis.pdf

The Chair of Mathematical Theory of Intelligent Systems and . Laboratory of Problems of Theoretical Cybernetics . ... MaTIS Chair . ... Research . ... Computer Solver . ... development of computer teaching systems . Information Monitoring . creating the systems of information monitoring . Search in Databases . systems of fast search in extensive databases . ... The Chair of Mathematical Theory of Intelligent Systems, Laboratory of Problems of Theoretical Cybernetics . ...

Еще в разделе: (Показать все результаты (>135) - www.intsys.msu.ru/ )

• Intelligent Systems :: Staff :: Gasanov Elyar Eldarovich
• Intelligent Systems :: Research
• Intelligent Systems :: Research :: Computer Solver

... О UNИX . ... HelpOnInstalling . Неизменяемая страница . ... HelpForAdministrators > HelpOnInstalling . ... For standard wiki installations you need to do a /BasicInstallation . ... Standard Wiki installations . Public wiki using CGI . ... Wiki Farming . ... A note about using Distribution versions: Some Linux distributions come pre-packaged with MoinMoin already installed. ... Create a directory for your farm, and under it, make two data trees per the /WikiInstanceCreation instructions. ...

Еще в разделе: (Показать все результаты (>112) - uneex.mithril.cs.msu.su/ )

• HelpOnLinking - UNИX

... Conferences . ... International Scientific Conference "Probability Theory and its Applications" on Occasion of the 85-th Birthday of Yu.V.Prokhorov is organized by the Steklov Mathematical Institute , Faculty of Computational Mathematics and Cybernetics of Moscow State University , and Institute for Informatics Problems of Russian Academy of Sciences from 12 to 14 of February, 2015. ... CMC MSU students at GSIS Summer School, Tohoku University, Japan . ... CMC MSU тИТ GSIS Tohoku IT Joint Seminar . ...

Еще в разделе: (Показать все результаты (>259) - en.cs.msu.ru/ )

• Department of Functional Analysis and its Applications | CMC MSU
• Laboratory of Mathematical Problems of Computer Security | CMC MSU
• Laboratory of Industrial Mathematics | CMC MSU

Title Author Key words The traditional family in the big city: social atavism and essential value Novoselova E.N. depopulation, urbanization, agglomeration, megalopolis, crisis of family, reproductive behavior, childfree, alternative forms of marriage, egoism, social infantilism The current article examines the problem of the critical demographic tendencies in Russia. ...

Еще в разделе: (Показать все результаты (>74) - www.socio.msu.ru/ )

• http://www.socio.msu.ru/vestnik/archive/2011/2/06.pdf
• http://www.socio.msu.ru/vestnik/eng/archive/2014/4/02.pdf

... General Information . ... For physics faculty . ... For natural faculties . ... Institute of General Physics RAN (Moscow) . ... Kazan State University (Kazan) . ... the science laboratories and group of the department have broad contacts with science and educational institutions around the globe: . ... Institute of Solid State Physics, Tokyo University . ... Institute of Solid State Physics, Vienna University of Technology . ... Institute of General Physics, Dresden Technical University, Germany . ...

Еще в разделе: (Показать все результаты (>33) - ferro.phys.msu.ru/ )

• Physics Department of Moscow State University

... Revision Log . ... When you browse the repository, it's always possible to query the Revision Log view corresponding to the path you're currently seeing. ... It's possible to set the revision at which the revision log should start, using the View log starting at field. ... It's also possible to indicate that one wants to see what happened before a Copy or Rename change, by selecting the Follow copies mode. ... Clicking on this column refreshes the revision log so that it restarts with this change. ...

Еще в разделе: (Показать все результаты (>5665) - kodomo.cmm.msu.ru/ )

• TracReports тАУ Tanchiki
• WikiProcessors тАУ Tanchiki

... Department . ... Department of the Automation for Scientific Research (ASR) was founded in 1988 on the basis of research and teaching group of the Mathematical Physics Department (former Department of Computational Mathematics). ... Under his guidance the department performs wide spectrum of research in the field of computer simulation of complex systems and processes. ... 2008?2016 ASR Department , CMC Faculty , Lomonosov MSU . ...

Еще в разделе: (Показать все результаты (>21) - ani.cmc.msu.ru/ )

• The ASR Department at the CMC Faculty of Lomonosov MSU
• Courses | Department of the Automation for Scientific Research CMC MSU
• Department of the Automation for Scientific Research CMC MSU | Computational

... I learned about this institution, its students, and its importance in the academic and political life of Moscow and Russia, which gave me a different perspective on MSU. ... I have encountered no "gender" problem. Prospective students to the US should know more about American institutions and their willingness to host Russian students. ... Russia needs to participate in the European community of scholars. ... Money is the main problem I see in Russian institutions. ...

Еще в разделе: (Показать все результаты (>200) - www.prof.msu.ru/ )

• Membership
• Some Ideas in Current Situation in our Country
• Region Department of Moscow oblast'

e-mail: alena_n_@mail.ru, nauka@socio.msu.ru) , , , , , , , , depopulation, critical tendencies of family transformations, reproductive behavior, childfree, alternative forms of marriage, same-sex marriage, assisted reproductive technology, egoism, social infantilism , , . ... The author reveals the link between the critical demographic tendencies and such fundamental problems of modern society as egoism and infantilism. ... The author of the article is trying to answer this question. ...

Еще в разделе: (Показать все результаты (>80) - vestnik.socio.msu.ru/ )

... G. A Leikin, A. N. Sanovich. Sternberg Astronomical Institute, Moscow 119899, Russia. Brown University - Vernadsky Institute Microsymposium 34, October 8-9, 2001, Moscow, Russia . ... G. A. Leikin and A. N. Sanovich, Sternberg State Astronomical Institute, Moscow State University, . ... Brown University - Vernadsky Institute Microsymposium 38, October 27-29, 2003, Moscow, Russia . ... Sternberg State Astronomical Institute, Moscow, State University, 119992, Moscow, Universitetskij prosp. ...

Еще в разделе: (Показать все результаты (>147) - selena.sai.msu.ru/ )

• Vladislav V. Shevchenko
• Санович А.Н.
• Department of Lunar and Planetary Research

... Boris A. Grishanin is an Associate Professor in the Department of Physics, M.V.Lomonosov Moscow State University (MSU). He received his M.S. and Ph.D. degrees from MSU in 1963 and 1968, respectively (both in Physics). ... B. A.Grishanin's current research interests are in the field of quantum theory of open systems, laser physics, molecular dynamics of photoexcited molecules, problems of quantum information and quantum computing. ... Information theory . ... 2016 Quantum Information Laboratory. ...

Еще в разделе: (Показать все результаты (>80) - qilab.phys.msu.ru/ )

... Line: 1 to 1 . ... TWiki Plugins . ... Changed: . ... And having to list all available Plugins will probably come up. ... Installed Plugins can be toggled on or off , site-wide or by web, through TWikiPreferences and individual WebPreferences: . ... Plugin status variables let you list all active Plugins wherever needed. ... The %ACTIVATEDPLUGINS% variable lists activated Plugins by name. ... Method 2: List the Plugin under test in the DISABLEDPLUGINS variable in TWikiPreferences . ...

Еще в разделе: (Показать все результаты (>49997) - dualopt1.cmm.msu.ru/ )

• AccessKeys - TWiki - TWiki
• %TOPICTITLE% (4 vs. 5) - TWiki
• TWikiContribs - TWiki - TWiki

... Its products including handbags, . ... louboutin outlet italia , jewelry, clothes and alternative things that perfectly express the spirit of classic and fashions. People who select Hermes think that going barefoot is a representative of design. All of their products touch most up-to-date fashion. Among its a lot of products, watch is a merchandise that ranking at their heads of the watch world. ...

Еще в разделе: (Показать все результаты (>52) - elana.sinp.msu.ru/ )

Ab out Research in Sverdlovsk-Ekaterinburg Initiated by the Maximum Principle of L.S . Pontryagin Nikolai Krasovskii Institute of Mathematics and Mechanics, UrB RAS, S. Kovalevskoi 16, Ekaterinburg, 620219, Russia In the fifties Professor E. A. Barbashin (1916-1969) ­ a graduate from the A.M. Gorky USU, was trained in traditions of the Moscow mathematical school in the field of topology, theory of dynamical systems and had achievements recognized in this field. ...

Еще в разделе: (Показать все результаты (>62) - pont2008.cmc.msu.ru/ )

• http://pont2008.cs.msu.ru/files/en/abstracts/Gamkrelidze.pdf

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>18) - mouse.genebee.msu.ru/ )

... Status of the Institute . ... The International Society for the Study of Time . ... Helping researchers to understand the diverse implicit and explicit notions of 'time' that predominate in numerous scientific disciplines . ... The upkeep, management, support, enlargement, and improvement of the institute's virtual library: "Bibliokhronos" . The upkeep, management, support, enlargement, and improvement of the institute's catalogue of publications topically concerned with time studies . ...

Еще в разделе: (Показать все результаты (>521) - chronos.msu.ru/ )

• The Institute for Time Nature Explorations
• Laboratory-Division Quantum Electrodynamics of Self-Organizing Systems and
• Russian Interdisciplinary Temporology Seminar

... Russian Pages . CDFE: Home Page . ... Numerical data, graphics, and bibliography . ... description] . Last updated: May 6th, 2014 . ... Last updated: June 15th, 2011 . ... Last updated: . ... Last updated: April 4th, 2015 . ... Last updated: February 25th, 2016 . ... Last updated: September 27th, 2011 . ... Photonuclear Data Index since 1955 . ... Last updated: September 15th, 2015 . ... Last updated: March 22th, 2010 . ... Last updated: March 19th, 2015 . ... Last updated: May 15th, 2002 . ...

Еще в разделе: (Показать все результаты (>4931) - cdfe.sinp.msu.ru/ )

• CDFE => Online Services => Relational ENSDF
• CDFE provides the major photonuclear databases. Online Services.
• CDFE => Useful links

You are here: Foswiki > System Web > JQueryPlugin > JQueryTabpane (revision 2) (raw view) E dit A ttach . ... Pellentesque et mi %ENDTAB% %TAB{"Tab 1.2"}% tristique ligula suscipit suscipit. ... Sed nisl. Pellentesque mattis, quam ut nonummy rutrum, sem felis ultrices nunc, sed mollis dolor diam et purus. ... Integer sed eros. ... Proin enim nunc, rutrum et, congue mattis, ultrices at, %ENDTAB% %TAB{"Tab 2"}% consectetuer, lectus justo faucibus arcu, et cursus velit felis eu lorem. ... System . ...

Еще в разделе: (Показать все результаты (>48904) - wiki.cmc.msu.ru/ )

• JQueryAutocomplete < System < Foswiki