... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Optical metamaterials represent specially designed structures, which possess optical properties not observable for ordinary bulk medium. ... Nanophotonics of surface states in photonic crystals . Research joined under the name ?Nanophotonics of surface states in photonic crystals?, carried out in the laboratory, are aimed to the study of properties of surface electromagnetic waves (SEWs), Tamm plasmon polaritons (TPPs), guided modes, which arise inside or at the surface of photonic crystals. ...
This section of library contains information about "classic" Star Catalogs. ... For a Henry Draper Catalog 272149 stars have received a total of 531,211 identifications in 7 сatalogs: . 270456 - in Astrographic Catalogue ( "Carte du Ciel", 4M), . 251943 - in Guide Stars Catalog (GSC), . ... A file with information on the components of 1788 of multiple systems in catalog HDEC (3681 component, or a combination thereof, with 4054 recording). ... A file with information about 21971 variable stars. ...
системы автоматизации, автоматизированные системы , информационные системы , мобильные и встраиваемые системы , программное обеспечение, вычислительные системы , средства связи,базы данных, информационные технологии,технологии программирования, обработка изображения, параллельные вычисления, информационное моделирование,математическое моделирование, вычислительный эксперимент, информатика,методы вычислений, численный анализ, numerical ...
. Strict Standards : Only variables should be assigned by reference in /storage0/www/http/fengoffice/environment/classes/debug/BenchmarkTimer.class.php on line 273 . Strict Standards : Only variables should be assigned by reference in /storage0/www/http/fengoffice/environment/classes/debug/BenchmarkTimer.class.php on line 297 . Забыли пароль . E-mail адрес: . Выслать пароль ( Вход ) .
T.V. Tyupikova, V.N. Samoilov The automated networks of management of financial activity, the control and the account of databases of economic divisions Joint Institute for Nuclear Research. ... Now let's consider concepts "an elementary object" and "a conditional unit of the information" with reference to systems of the analysis and management of the financial and economic activity of anthe enterprise. ... The address part of the elementary object is the number of the account (or of the subaccounts). ...
[
Текст
]
Ссылки http://acat02.sinp.msu.ru/presentations/tyupikova/doclad.doc -- 200.0 Кб -- 09.07.2002 Похожие документы
Documentation on Firefly v. 8.0.0 numerical gradient features . The numerical gradient code is activated as follows: . ... The primary purpose of this code is to allow computations normally requiring analytic energy gradients, to be performed using those QC methods for which analytic gradients are not yet programmed. ... The numerical gradients code is tightly integrated into Firefly and can be used anywhere where the analytical energy gradients are required by default. ... The default is 2. ...
Study of jet transverse structure with CMS experiment at 10 TeV Natalia Ilina (ITEP, Moscow) for the CMS collaboration CMS PAS QCD-08-002 (2009) 1 LOMONOSOV09, MSU, Moscow 24/08/2009 Outline 1. ... 7 LOMONOSOV09, MSU, Moscow 24/08/2009 Monte Carlo predictions HERWIG++ Particle level Jet transverse structure for all jets (black lines) depends on while it does not depend on for gluon and quark jets. ...
... Home . ... Board of directors . About the project . ... Read more . ... Project director . ... PhD, Research Associate . Director of the scientific part of the project . ... PhD, Deputy Vice-Rector . Technical Coordinator . ... Project coordinator . ... Coordinator of "Biological information" part of the project . ... Coordinator of "Human biomaterial" part of the project . ... Coordinator of "Animals" part of the project . ... Coordinator of "Plants" part of the project . ...
... Computer software has been developed for crystal chemistry analysis of arrangement of molecules in organic crystals on the basis of concepts worked out in the studies conducted by P.M.Zorky et al. ... The standard crystal chemistry analysis includes: . ... Constructing various graphic representations of the crystal structure and of its fragments, which clearly demonstrate arrangement of molecules, in particular, constructing representations of the most close molecule-molecule contacts. ...
... Let $(X_n)$ be a strictly stationary random sequence with the marginal distribution functions $F(x)=P{X_1\leq x}$. ... Let us denote $ M_n=\max {X_1,.. ... The limiting distributions of the random vector $(\tilde{M_n}, M_n)$ and "asymptotic independency" of $\tilde{M_n}$ and $M_n$ are obtained under some condition of weak dependency of random variables from sequence $(X_n)$, which is more restrictive than Leadbetter's $D(u_n)$ condition, and some conditions on the sequence $(\varepsilon_n)$. ...
: «SAP HANA the main memory database platform for modern hardware» «SAP HANA » 23 2013 . 18.30 : Franz Faerber, : - SAP SAP HANA (High-Performance Analytics Appliance) , . «in-memory» SAP . , SAP HANA «in-memory» , , . SAP HANA , SAP HANA, SAP Labs . : Franz Faerber, SAP 1994 ., - SAP. SAP HANA, . : . .. , (2- ), . -8 ! 22 : mag-prog@lvk.cs.msu.su http://erp.cmc.msu.ru/ 247, : +7 (495) 939-55-68
... Publications . ... Borisov A. V. , Kilin A. A. , Mamaev I. S. , Tenenev V. A. The dynamics of vortex rings: leapfrogging in an ideal and viscous fluid . ... Vetchanin E. V. , Mamaev I. S. , Tenenev V. A. The Self-propulsion of a Body with Moving Internal Masses in a Viscous Fluid . ... Vetchanin E. V., Tenenev V. A., Shaura A. S., Motion control of a rigid body in viscous fluid, Computer Research and Modeling, 2013, vol. 5, no. 4, pp. ... Institute of Computer Science Izhevsk, 2005 - 2016 . ...
... Магистерское образование . ... Магистерские программы . ... This is an obligatory course for 1-year students, studying for the magisterial degree ?Open Information systems? and ?Network software?. ... Are researched the most frequently used applied protocols of net security and protocol of creating virtual private nets. ... This is an obligatory course for 1-year students, studying for the magisterial degree ?Program devices of net?. ... Магистратура: master@cmc.msu.ru, 3-й этаж, комната 360, тел. ...
... Russian–German conference on Several Complex Variables . Moscow, Russia . 27 February-2 March 2012 . The Second International Conference . K-Theory, C*-algebras and Topology of Manifolds II . ... International Topological Conference . ... School: 18-22 June 2012 . ... 25-30 June 2012 . ... 23 July-10 August 2012 . ... Yaroslavl international conference . ... Fourth Arolla Conference on Algebraic Topology . ... International conference . ... Topology ATLAS: Conferences and Seminars . ...
... Authors: R. P. Eatough et al. arxiv:1308.0358 PSR J2021+4026 в области гамма Лебедя: первый переменный гамма-пульсар Ферми (PSR J2021+4026 in the Gamma Cygni region: the first variable gamma-ray pulsar seen by the Fermi LAT) . Authors: Fermi/LAT collaboration . arxiv:1308.2914 Сетка звездных моделей с вращением - III. модели от 0.8 до 120 Msun для металличности Z = 0.002 (Grids of stellar models with rotation - III. Models from 0.8 to 120 Msun at a metallicity Z = 0.002) . ...