... x264 is an open source codec of standard MPEG4 AVC/H.264, developed by programmers from all over the world. ... Accumulated during previous frames' compressions statistic is actively used by codec to improve effectiveness of adaptive models. ... These parameters are used only before encoding start, so, our improvements are more significant for short sequences. ... 3 Results of codec x264 modification on "flower" sequence . ... 5 Results of codec x264 modification on "flower" sequence, low bitrates ....

Еще в разделе: (Показать все результаты (>912) - graphics.cs.msu.ru/ )

• GML LidarK Library | Graphics and Media Lab
• MSU Video Codec Comparison | Graphics and Media Lab
• Keyframe-based Depth Compression (Update) | Graphics and Media Lab

... Second-year students classes . Introduction to Linux . ... 32-bit Microcontroller Programming . ... In the given practical special course we address user techniques for working with Linux OS; we study the interface of the command line in great detail, methods of automation and batch processing, composition of scientific articles as well as the specifics of software design by using in-built toolkit. ... Use of console interface of the command line, automation (bash scripts) . ...

Еще в разделе: (Показать все результаты (>83) - engineering.phys.msu.ru/ )

• Microcontroller Control of Motors
• Parallel Programming
• C Language

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>28) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

The Chair of Mathematical Theory of Intelligent Systems and . Laboratory of Problems of Theoretical Cybernetics . ... MaTIS Chair . ... Research . ... Computer Solver . development of the Automatic solver of mathematical problems . ... Search in Databases . ... Here is a lecture notes in Russian by A.S. Podkolzin " Computer modeling by mathematical problems solving ". ... The Chair of Mathematical Theory of Intelligent Systems, Laboratory of Problems of Theoretical Cybernetics . ...

Еще в разделе: (Показать все результаты (>142) - www.intsys.msu.ru/ )

• Intelligent Systems :: Research :: Computer Teacher
• Intelligent Systems :: News
• Intelligent Systems :: Magazine :: Web archive :: Volume 16, issue 1-4, 2012

... Полная версия этой страницы: Работа в Samsung . Студенческий форум Физфака МГУ > Общий > Работа . ... Telecommunication Network . ... Job Summary: The Optical Engineer will be involved in the design, fabrication and testing of optical/digital imaging system for mobile devices. ... Required Skills: Must have proven optical design and algorithm skills, lens design experience using code-V or equivalent lens design software. ... Company: Samsung Electronics Telecommunication Network Business . ...

Еще в разделе: (Показать все результаты (>1878) - wasp.phys.msu.ru/ )

• Работа в Samsung - Студенческий форум Физфака МГУ
• Студенческий форум Физфака МГУ > Работа в Samsung Electronics для математиков и
• Студенческий форум Физфака МГУ > Компании ДС БАРС требуется Java-программист

Parasitology \ Laboratory for Fauna and Systematics of Parasites \ Publications . ... Hominick, W.M., B.R. Briscoe, Del Pino F., D.J. Hunt, Kozodoy E., Mracek Z., Nguyen K., Reid A.P., Spiridonov S.E. Stock P., Sturhan D., Waturu C., Yoshida M. Biosystematics of entomopathogenic nematodes: current status, protocols and definitions. Journal of Helminthology, 1997, vol. 71, p. 271-298. ... International Journal of Nematology, 1997, vol. ... Systematic Parasitology, 2005, vol. 60, p. 91-97. ...

Еще в разделе: (Показать все результаты (>10771) - www.sevin.ru/ )

• Laboratories: Group for Bioinformatics and Modeling Biological Process: Results
• Laboratories: Group of Invasion Ecology and Interpopulation Interactions:
• A. N. Severtsov Institute of Ecology and Evolution: english version

download:main ]] . CompHEP . ... Latest versions . ... This Licence entitles the Licensee (one person) and the Licensee's research group to obtain a copy of the source or executable code of CompHEP and/or interfaces of CompHEP to other Monte-Carlo generators and to use the acquired program for academic research or other non-profit purposes within a research ... Source codes of CompHEP, v4.5.2 (release candidate 12) . ... Source codes of CompHEP, v4.4.93 (preliminary test version of 4.5.0) . ...

Еще в разделе: (Показать все результаты (>25) - comphep.sinp.msu.ru/ )

• install [CompHEP]
• news [CompHEP]
• download:rn-070605 [CompHEP]

You are here: Foswiki > System Web > Plugins > HistoryPlugin > VarHISTORY (13 Mar 2011, ProjectContributor ) E dit A ttach . ... Default layout: a simple list of topic revisions using the default format (see below) . ... versions="number or range" . ... To get version 2, write: versions="2" . ... May contain the tokens $next and $previous which will be evaluated if there are newer or older revisions available for the topic that are not listed according to versions (or rev1 , rev2 , nrev ). ...

Еще в разделе: (Показать все результаты (>32809) - wiki.cmc.msu.ru/ )

• WebHome < System < Foswiki
• VarHTTPS < System < Foswiki

... Publications . ... Number of publications 0 . ... Publication type . ... Borisov A. V. , Kazakov A. O. , Sataev I. R. The Reversal and Chaotic Attractor in the Nonholonomic Model of Chaplygin?s Top . Regular and Chaotic Dynamics, 2014, vol. 19, no. 6, pp. ... Borisov A. V., Kazakov A. O., Sataev I. R., Regular and Chaotic Attractors in the Nonholonomic Model of Chapygin's ball, Russian Journal of Nonlinear Dynamics, 2014, vol. 10, no. 3, pp. ... Institute of Computer Science Izhevsk, 2005 - 2016 . ...

Еще в разделе: (Показать все результаты (>223) - ics.org.ru/ )

• Institute of Computer Sciences - Conferences - International Conference "Metric
• Institute of Computer Sciences - Conferences

... Algorithmization of radiation analysis during the quality control of plant raw materials used in medicine . Abstract A versatile procedure of radiation analysis is developed for controlling the quality of medicinal plant raw materials. ... Moscow University Chemistry Bulletin . 2002, Vol. ... 3, P. 194 . Copyright (C) Chemistry Dept., Moscow State University, 2002 . ... Copyright (C) Chemisty Department of Moscow State University . ... Web-design: Copyright (C) MIG and VVM . ...

Еще в разделе: (Показать все результаты (>951) - chem.msu.ru/ )

• Moscow University Chemistry Bulletin Vol. 45, No. 1, P. 38 (2004)
• Moscow University Chemistry Bulletin Vol. 51, No. 6, P. 427 (2010)
• Conformational analysis of boron-containing compounds using Gillespie-Kepert

... PDB . ... Domain instances . ... TRANSFERASE/DNA/RNA . ... TRANSFERASE/IMMUNE SYSTEM/DNA . ... TRANSFERASE/DNA . ... TRANSFERASE/ANTIBODY/DNA . ... IMMUNE SYSTEM/DNA . ... total (10 entries) . ... No comments on this family . ...

Еще в разделе: (Показать все результаты (>1359) - monkey.belozersky.msu.ru/ )

• PDB entries containing domains of the family "Reverse transcriptase
• PDB entries containing domains of the family "Reverse transcriptase thumb
• SCOP classification

Welcome to K -corrections calculator, simple service allowing one to determine K -corrections of a galaxy, given its redshift and one or more colours. ... Please note that galaxy redshift should stay in the range between 0.0 and 0.5. ... K -correction in choose filter.. AB mag --- SDSS u SDSS g SDSS r SDSS i SDSS z UKIDSS Y UKIDSS J UKIDSS H UKIDSS K --- Vega mag --- Johnson U Johnson B Johnson V Cousins Rc Cousins Ic 2MASS J 2MASS H 2MASS Ks . Redshift . Colour choose colour.. ...

Еще в разделе: (Показать все результаты (>7) - kcor.sai.msu.ru/ )

BS - 2D data processing program. BS is a windows version of the 2D X-ray data processing program BSL in use at the Daresbury Synchrotron radiation source, for the treatment of low angle diffraction data. ... It requires less memory, has separate window to see 1D graphics and allows export of the image in two common formats: BMP and TIFF. ... information about the data file .adc . add a constant to selected range in n frames from file .add . weighted addition of two images .arg . ...

Еще в разделе: (Показать все результаты (>2) - muscle.imec.msu.ru/ )

... The 6th Moscow International Conference on Operation Research (ORM-2010) was held on 19-23 of October 2010 in Moscow. ORM is a triennal conference organized by Dorodnicyn Computing Center of the Russian Academy of Sciences (RAS), Lomonosov Moscow State University and Russian Scientific Operation Research Society. ... A. Vasin was optimistic about the further integration of the Russian of the Russian OR community as he himself is already actively involved in conferences of GOR, EURO and IFORS. ...

Еще в разделе: (Показать все результаты (>65) - io.cmc.msu.ru/ )

• The Department of Operations Research

... Дайджест психологических исследований . ... применение тестов математические методы в психологии анализ и визуализация данных результаты выборов математические методы наука юмор организационная психология диссертация hr выборы диссертации эксперименты геолокация опросы ссылки профессии мотивация психодиагностика MS Excel онлайн-сервисы SEM ubuntu психологические журналы R IBM SPSS Statistics фото SPSS рецензии онлайн исследования структурное моделирование анализ данных регрессионный ...

Еще в разделе: (Показать все результаты (>170) - tukachev.flogiston.ru/ )

• Tag: SPSS Evaluation Version
• Tag: SEM
• Coursera?s Computing for Data Analysis course on R

... To acquaint the reader with nonlinear dynamic systems; . ... The geology investigates of the Earth as a dynamic system. ... The analysis of behavior of systems with nonlinear interplay during time is a subject of this E-textbook. ... Key words: geological processes, dynamic system, nonlinear processes, chaotic dynamics, deterministic chaos, fractals. ... Chapter 1. ... For more information concerning the E-textbook "Dynamic processes in geology: Introduction to nonlinear systems" refer to the...

Еще в разделе: (Показать все результаты (>29) - dynamo.geol.msu.ru/ )

... This 0.5 - year course is devoted to the principles of mathematical modeling in human investigation on physical, economical and social natures. ... Modern Operating Systems . ... This is introductory course to computer network technologies. ... It covers vary basically ISO OSI RM, TCP/IP protocol stack, Ethernet and WiFi principles, core network technologies, PSTN and GSM, main threats and vulnerabilities, and also popular cryptographic technologies and secure network protocols. ...

Еще в разделе: (Показать все результаты (>24) - hcs.cmc.msu.ru/ )

• Master program "Open Information Systems" | Магистерское и послевузовское
• Master program "Network Software" | Магистерское и послевузовское образование
• Master program "Mathematical and computer methods of image processing" |

... Computer Phys. Comm , Computer Physics Communication . ... в журнале Computer Physics Communications , издательство Elsevier BV (Netherlands) , том 198, с. 12-21 DOI . ... Yurchenko Sergei N., Lodi Lorenzo, Tennyson Jonathan, Stolyarov Andrey V. в журнале Computer Physics Communications , издательство Elsevier BV (Netherlands) , том 202, с. 262-275 DOI . ... Smirnov Alexander V. в журнале Computer Physics Communications , издательство Elsevier BV (Netherlands) , том 189, с. 182-191 DOI . ...

Еще в разделе: (Показать все результаты (>3409) - istina.msu.ru/ )

• Computers and Operations Research - журнал | ИСТИНА - Интеллектуальная Система
• Automatic Control and Computer Sciences - журнал | ИСТИНА - Интеллектуальная
• Journal of Computer Systems, Networks, and Communications - журнал | ИСТИНА -

New GCVS Versions for Three Southern Constellations Peremennye Zvezdy (Variable Stars) 27, No. ... We are currently working on a version of the General Catalogue of Variable Stars (GCVS) revised taking into account the new data accumulated since the 4th GCVS edition. ... It will contain all stars of the 4th GCVS edition plus a complete catalogue of the stars added to the GCVS in the Name Lists of Variable Stars Nos. ...

Еще в разделе: (Показать все результаты (>112) - sai.msu.ru/ )

• General Catalogue of Variable Stars: Description
• General Catalogue of Variable Stars: What's new.
• Второй пробный вариант классификации (11 мая 2006 г

Антонов А.С. Параллельное программирование с использованием технологии MPI: Учебное пособие. М.: Изд-во МГУ, 2004.-71с. Антонов А.С. Практический курс MPI. ... М.: Изд-во МГУ, 1991.-345с. Воеводин В.В. Параллельные структуры алгоритмов и программ. ... J. Choi, J. Dongarra, and D. Walker, PB-BLAS: A Set of Parallel Block Basic Linear Algebra Subroutines, Practice and Experience, 8 (1996), pp. 517-535. http://www.netlib.org/scalapack/html/pblas_qref.html/. ...

Еще в разделе: (Показать все результаты (>809) - num-anal.srcc.msu.ru/ )