... Applications of Molecular Mechanics to Metal Complexes" . ... Molecular mechanics study of the mixed-ligand lanthanide complexes using Gillespie-Kepert model . ... Within MM-GK, the same parameters are applicable to complexes of different coordination numbers/polyhedra. ... Gillespie-Kepert model . ... Using derived computational parameters, we calculated the geometry of 39 lanthanide ion nonaaqua complexes, 6 octaaqua complexes and 18 beta- diketonate and aqua-beta-diketonate complexes. ...

Еще в разделе: (Показать все результаты (>30) - analyt.chem.msu.ru/ )

• Molecular Mechanics Calculations of beta-Diketonate, Aqua, And
• The Molecular Mechanic Approach to Coordination Compounds: Force Field Based on

... Line: 1 to 1 . ... NOTE : The result from changes script and the topic WebChanges can be different, if the changes file is deleted from a web. ... Note: The manage script can only be called via http POST method for createweb renameweb , and deleteUserAccount . ... Note: The register script can only be called via http POST method, not GET. ... Note: The rename script can only be called via http POST method, not GET. ... Note: The save script can only be called via http POST method, not GET. ...

Еще в разделе: (Показать все результаты (>38920) - dualopt1.cmm.msu.ru/ )

• %TOPICTITLE% (2 vs. 3) - TWiki
• %TOPICTITLE% (17 vs. 18) - TWiki

... In this case both the medium and the electric field depend on two space coordinates only. ... The classical modeling presentation is in apparent resistivity which reflects an electric field distribution on the earth's surface. ... An expression can be derived for the potential value in point M ([pic]): [pic], (4) where [pic] is the potential of the primary electric field, [pic] is the potential of the secondary electric field, defined by the surface charge distribution. ... pic] |[pic] | ...

Еще в разделе: (Показать все результаты (>70) - geophys.geol.msu.ru/ )

• http://geophys.geol.msu.ru/shevnin/publ/173.pdf
• http://geophys.geol.msu.ru/shevnin/publ/167.pdf
• Anis. Page2

... Data . ... Services . ... Solar energetic particles . ... N -d SW Conditions : Time profiles of the key geomagnetic ( Ap and Dst indices), solar wind (velocity V , density n and temperature T ) and IMF ( B , Bx , By , Bz in GSM) parameters observed in the N day vicinity of the geomagnetic disturbed day. N -d Map of Solar Events : Map of solar surface events occurred within N day vicinity of the moment when the solar wind expansion (which causes the geomagnetic event) started. ... WIND . ...

Еще в разделе: (Показать все результаты (>38) - smdc.sinp.msu.ru/ )

• COSRAD model - Space monitoring data center
• Scientific services - Space monitoring data center
• Paraboloid model of the Earth's magnetosphere - Space monitoring data center

COMPARISON OF CLUSTERING ALGORITHMS FOR SPEAKER IDENTIFICATION Nikolay Lubimov, Evgeny Mikheev, Alexey Lukin Moscow Lomonosov State University, Moscow, Russia In this paper we consider the problem of text-independent speaker identification that refers to acoustic recognition research. ... We have performed the comparison of different clustering methods for speaker identification: the standard K-means clustering, K-means++, Linde-Buzo-Gray, Fuzzy C-means, and Gustafson-Kessel algorithms. ...

Еще в разделе: (Показать все результаты (>184) - imaging.cmc.msu.ru/ )

• http://imaging.cs.msu.ru/pub/2011.Graphicon.Zipa_Ignatenko.MetallicCoating.en.pdf
• http://imaging.cs.msu.ru/pub/2011.Graphicon.Nasonov_Krylov.Metrics.en.pdf
• http://imaging.cs.msu.ru/pub/2009.ICIP.Nasonov_Krylov.RinMetr.en.pdf

... In particular spectral distributions of single counts and coincidence for pure biphoton states generated by a train of short pump pulses have been measured and the entanglement quantifier has been calculated. ... Considering that the pulse duration of the pump did not change we can observe that in this case the pump is 2.8 times greater than the coincidence spectrum whereas the single counts distribution is 64 times larger than the width of the pump. ... Phys. Rev. Lett., ... Phys., 9 (2006) S467. ...

Еще в разделе: (Показать все результаты (>138) - qi.phys.msu.ru/ )

• http://qi.phys.msu.su/papers/2007-prl-99-063901.pdf
• Quantum key distribution :: Quantum Information Laboratory
• Publications :: Quantum Information Laboratory

... Supercomputing Technologies in Science, Education and Industry Almanac Series . ... Octotron: Active Control for Reliable Functioning of Supercomputers . ... DiMMon: a New Approach to Supercomputer Monitoring . ... X-COM: Distributed Computing Software . ... We propose a new approach to building distributed modular monitoring system named DiMMon, both for current and future systems, with an extremely high degree of parallelism. ... Research Computing Center (RCC) of Lomonosov Moscow State University...

Еще в разделе: (Показать все результаты (>69) - hpc.msu.ru/ )

• APPLICATIONS: Astronomy | Moscow University Supercomputing Center
• APPLICATIONS: Mechanics | Moscow University Supercomputing Center

. G. P. Shpenkov, L. G. Kreidik. Conjugate Parameters of Physical Processes and Physical Time (PDF-file, 370 Kb) [distributed 25.10.2009] . G. P. Shpenkov, L. G. Kreidik Dynamic Model of Elementary Particles and Fundamental Interactions (PDF-file, 240 Kb) [distributed 05.10.2009] .

Еще в разделе: (Показать все результаты (>619) - chronos.msu.ru/ )

• Шпенков Г.П. (G. P. Shpenkov)
• Quantitative methods of ecological control:
• O.S.Razumovsky. Models of Time in Physics and Cosmology

... Voronov, Vasiliy. Scalability and efficiency of parallel power grid simulations on massively-parallel platforms (submitted). ... 2009. ... Voronov, Vasiliy and Popova, Nina. ... Conference proceedings 2010. ... Abstract Book of SIAM Conference on Parallel Processing for Scientific Computing (SIAM PP10). ... Proceedings of the International Conference on Parallel Computing (ParCo-2009). ... IEEE Computer Press. ... Pozdneev, Alexander and Popova, Nina and Voronov, Vasiliy. ...

Еще в разделе: (Показать все результаты (>5) - angel.cmc.msu.ru/ )

... Criteria of branch quality . As it was repeatedly told , phylogenetic trees consist from branches. ... I. e., those positions, which can separate sequences of the branch from other sequences in the alignment. ... Measure of branch separation . ... Here and further: A - branch of the tree, i , j - sequences of alignment . ... That's why number of conserved positions in some branch should be considered in complex with the distribution of conserved positions in the whole alignment. ...

Еще в разделе: (Показать все результаты (>5485) - monkey.belozersky.msu.ru/ )

• Inquiry information || Rule of four sequences
• Inquiry information || Distances
• HF clusters: algorithm

Predictor of DVM-program performance . User's guide . ... With the predictor user can get the predicted time characteristics of execution of his program on MPP or workstation cluster in more or less details. The predictor is the system for processing the trace information gathered by DVM-program Run-Time system (Lib-DVM library) during the program execution on a workstation and consists of two major components: trace interpreter ( PRESAGE) and time estimator (RATER). ... Program execution. ...

Еще в разделе: (Показать все результаты (>149) - sp.cs.msu.ru/ )

• Explicit cyclic schemes for space neutron kinetics in (Hex-Z) geometry
• Lib-DVM. Detailed design
• Fortran DVM language description. Part 3 (7-12)

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>11) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... This gropup of options allows You to change the following speech recording parameters: . ... This gropup of options allows You to change the following parameters of linear prediction: coefficients calculation: . ... This gropup of options allows You to change the following speech processing parameters: . ... This gropup of options allows You to change the following speech recognition parameters: . ... This gropup of options allows You to change the following speech detection parameters: . ...

Еще в разделе: (Показать все результаты (>66) - www.intsys.msu.ru/ )

• Options
• Intelligent Systems :: Research :: :: Articles

NAME httpd - Apache hypertext transfer protocol server SYNOPSIS httpd [ - X ] [ - R libexecdir ] [ - d serverroot ] [ - f config ] [ - C directive ] [ - c directive ] [ - D parameter ] httpd [ - h ] [ - l ] [ - L ] [ - v ] [ - V ] [ - S ] [ - t ] [ - T ] DESCRIPTION httpd is the Apache HyperText Transfer Protocol (HTTP) server program. ... This manual page only lists the command line arguments. ... Paths in this manual may not reflect those compiled into httpd. ... The default is /usr/local/apache . ...

Еще в разделе: (Показать все результаты (>113) - neptun.sai.msu.ru/ )

• Using Apache with HP MPE/iX
• Upgrading to 1.3 from 1.2
• Source Re-organisation

Buffer phenomenon in mathematical mo dels of natural sciences Mishchenko E. F. Steklov Institute of Mathematics, Russian Academy of Science e-mail: mishch@mi.ras.ru Kolesov A. Yu. Demidov Yaroslavl State University e-mail: kolesov@uniyar.ac.ru Rozov N. Kh. ... 3] Kolesov A.Yu., Mishchenko E.F., and Rozov N.Kh., ... Math., ... 6] Kolesov A.Yu., and Rozov N.Kh., ... The Buffer Phenomenon in Combustion Theory", Dokl. ... 13] Mishchenko E.F., Sadovnichii V.A., Kolesov A.Yu., and Rozov N.Kh., ...

Еще в разделе: (Показать все результаты (>21) - pont2008.cmc.msu.ru/ )

• http://pont2008.cs.msu.ru/files/en/abstracts/Gamkrelidze.pdf
• http://pont2008.cs.msu.ru/files/en/abstracts/Agrachev.pdf

A GENETIC ALGORHYTM FOR OPTIMIZING A NEURAL NETWORK CAPABLE TO LEARN FOR FOOD SEARCHING IN A RADIAL MAZE Budilova E.V., Chepurnova N.E., Chepurnov S.A, Teriokhin A.T. M.V.Lomonosov Moscow State University, Dept. of Biology. ... The upper platform has a hole in the middle and several radially directed tubular canals ("arms") each of which can contain a peace of food and has doors opening only in the centrifugal direction. ... The task of the animal is to visit only those arms which contain food. ...

Еще в разделе: (Показать все результаты (>39) - ecology.genebee.msu.ru/ )

• http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2000_Longev_JEvolBio.pdf
• http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2008_R0r_EcolMod.pdf

Development of new approaches to the analysis of ring shapes in organic molecules and the description of electronic distribution (atomic charges) and halogen bonding in the framework of forcefield model for rapid estimation of intra- and intermolecular interaction energies in molecular mechanics, molecular dynamics and docking methods . Forcefield is a model and a set of parameters for theoretical description of intra- and intermolecular interactions. ... 2016 Laboratory of Medicinal Chemistry ...

Еще в разделе: (Показать все результаты (>7) - qsar.chem.msu.ru/ )

... Help/Guide . About Trac . ... Ticket data can be imported from Bugzilla using the тАЛ bugzilla2trac.py script, available in the contrib/ directory of the Trac distribution. $ bugzilla2trac.py bugzilla2trac - Imports a bug database from Bugzilla into Trac. Usage: bugzilla2trac.py [options] Available Options: --db <MySQL dbname> - Bugzilla's database --tracenv /path/to/trac/env - full path to Trac db environment -h | ... Mantis bugs can be imported using the attached script. ...

Еще в разделе: (Показать все результаты (>1907) - kodomo.cmm.msu.ru/ )

• TracImport (diff) тАУ Tanchiki
• Petri dish
• Changeset 11:53672899af16 тАУ Petri Dish

... Distribution of neutron counting rate near the Earth surface is studied in two directions - to the Earth and from it - according experimental data, obtained in Moscow in 1996. ... We suppose that logarithmically normal distribution describes an input of the Earth crust into the neutron flux. ... Usual periods . ... Full approximation of thermal neutrons distribution near the Earth crust is presented as a sum of two functions - Poison distribution and logarithmically normal distribution. ...

Еще в разделе: (Показать все результаты (>109) - www.kosmofizika.ru/ )

... Preliminary Analysis of the Self Similarity of the Aftershocks of the Japanese Earthquake on March 11, 2011 V. S. Zakharov Faculty of Geology, Moscow State University, Moscow, 119991 Russia e mail: vszakharov@yandex.ru, zakharov@dynamo.geol.msu.ru Received October 11, 2011 Abstract--The quantitative parameters of the self similarity of the aftershocks of the Japanese earthquake on March 11, 2011 were obtained. ... Most aftershock hypocenters were located at a depth of 20­50 km. ...

Еще в разделе: (Показать все результаты (>22) - dynamo.geol.msu.ru/ )

• Summaries of articles
• Доклады В.С.Захарова