... Take latest Pacman and install it : Create somewhere directory software/ and simply untar Pacman there : cd software wget http://physics.bu.edu/pacman/sample_cache/tarballs/pacman-latest.tar.gz tar xzf pacman-latest.tar.gz # It will be created, for example, directory pacman-3.21/ rm -f pacman-latest.tar.gz ln -s pacman-* pacman cd pacman source setup.csh # or setup.sh cd .. ... For instance, if you do pacman -allow tar-overwrite this setting remains as a default until you change it. ...

Еще в разделе: (Показать все результаты (>10) - lhe.sinp.msu.ru/ )

PDF created with pdfFactory Pro trial version www.pdffactory.com , ґ , , , , . ... 7 2007 . ... http://www.everettica.org/art/Ev2.pdf PDF created with pdfFactory Pro trial version www.pdffactory.com ...

Еще в разделе: (Показать все результаты (>425) - chronos.msu.ru/ )

• http://temporology.bio.msu.ru/RREPORTS/eameba.pdf
• Laboratory-chair of modelling the natural references of time
• Laboratory-chair of Discrete mechanics on a microscopic scale

CDFE => Online Services => NSR Search Engine Description . This program lets to find articles from Nuclear Science References (NSR). I. Names and descriptions of NSR Search Engine fields . ... Quantity Type Parameter type of <SELECTRS>. ... Target nucleus Chemical symbol or charge and atomic number of target nucleus. ... Range of energy Range of reaction energy (Example: 0.3 - 1 GeV ). ... Example: 1998) . ... Work scheme NSR Search Engine. ... NSR Search Engine printscreen for example. ...

Еще в разделе: (Показать все результаты (>66) - cdfe.sinp.msu.ru/ )

• CDFE - Centre for Photonuclear Experiments Data - Home page
• CDFE => Online Services => Nucleus Ground State Parameters
• CDFE => Online Services => Calculator and Graph Engine for Atomic Nuclei

... Е. з. бДпДкъЦЗ м~В·М?И ^ВМЪ й·ВЛМВММУ,,У ЛМТЪЛЪЫЪ flВ М?i ЛТТОВУ,МЛИ, СЫ·М еУТНУ,ТНУИ У·О. © бi еВ, Е.з., 1996 ( ), . ... бДпДкъЦЗ Е.з. зйЗДь ланмДсаь З дЗДзнйЗйв еЦпДзадЦ 81 ). .. , . ... V = const sin(kx) ( cos(kx), exp(ikx), exp(- ikx)), k = E - V . V. , , , = 0 = a ( , 82 лйкйлйЗлдав йЕкДбйЗДнЦгъзхв ЬмкзДг, <7, 1996 ). , , , ( ). sin(nx) c : n = 1, 2, 3, ... , = 1, 4, 9, ... (. . ... 4. (, ) ( ). 86 лйкйлйЗлдав йЕкДбйЗДнЦгъзхв ЬмкзДг, <7, 1996 зЦгазЦвзхЦ мкДЗзЦзаь , V(x) S(E ) , , , . ...

Еще в разделе: (Показать все результаты (>190) - nuclphys.sinp.msu.ru/ )

• Recreation, 1983

... Data . ... Services . ... Solar energetic particles . ... N -d SW Conditions : Time profiles of the key geomagnetic ( Ap and Dst indices), solar wind (velocity V , density n and temperature T ) and IMF ( B , Bx , By , Bz in GSM) parameters observed in the N day vicinity of the geomagnetic disturbed day. N -d Map of Solar Events : Map of solar surface events occurred within N day vicinity of the moment when the solar wind expansion (which causes the geomagnetic event) started. ... WIND . ...

Еще в разделе: (Показать все результаты (>37) - smdc.sinp.msu.ru/ )

• About - Space monitoring data center
• OMNIweb mirror - Space monitoring data center
• Space monitoring data center

Diploma thesis abstract by Arslanov D.D. Generation and diagnostic of cluster beams of xenon by adiabatic explosion gas through conical nozzle. Developed and created experimental setup for formation a cluster beam by adiabatic expansion of gas through impact nozzle, consisting of a stagnation chamber, impact conical nozzle with electronic control system piezoceramics valve, interactions chamber, evacuation system. ... Have parameter estimates of cluster beam for an ideal impact conical nozzle. ...

Еще в разделе: (Показать все результаты (>133) - ofvp.phys.msu.ru/ )

• http://ofvp.phys.msu.ru/en/science_education/diploma/annot/2008/Golovin_Mikheev_en.pdf
• http://ofvp.phys.msu.ru/en/science_education/diploma/annot/2009/Indukaev_Priezzhev_en.pdf
• http://ofvp.phys.msu.ru/en/science_education/diploma/annot/2010/Ivanov_Uryupina_en.pdf

... PDF created with pdfFactory trial version www.pdffactory.com 2 . ... 2001. ... 1977. ... 1987. ... 1983, 1987. ... 1985. ...

Еще в разделе: (Показать все результаты (>22) - dynamo.geol.msu.ru/ )

The use of the external module Ab_An.dll Ab_An.dll file is an external module for the Gibbs program, and is designed to calculate the activity coefficients of the components of albite- anortite solid solution. ... A non-ideal model of albite-anortite solid solution, proposed in literature [1], is used in this module. ... Preparation of the System file To be able to use the module Ab_An.dll, you need to include a binary solid solution of albite and anortite into the System file, as you create it. ...

Еще в разделе: (Показать все результаты (>80) - www.geol.msu.ru/ )

• http://www.geol.msu.ru/deps/geochems/soft/en/Electrum.doc
• http://www.geol.msu.ru/deps/geochems/soft/en/H2O-H2S-NaCl.doc
• http://www.geol.msu.ru/deps/geochems/soft/en/GibbsLib.doc

... The main field of my investigations is stellar spectrophotometry. As a result of scientific activity of our group spectrophotometric catalog was created including energy distribution data on 900 stars in the range 3200-7600AA and 250 stars in the range 6000-10800AA (Voloshina et al., Spectrophotometry of Bright Stars, ed. I.N.Glushneva, 1982, Moscow, Nauka, in Russian). ...

Еще в разделе: (Показать все результаты (>44) - uranus.sai.msu.ru/ )

GEO, Geoinformation Instrumental Environment . ... Applications . ... GEO helps to create computer-based models of geological events and phenomenons by processing quality knowledge, experts evaluations of the forecast values and knowledge acquired from geological and geophysical data. ... The GEO environment integrates geographic information system (GIS) technology with case-based and knowledge-based system technologies. ... seismic hazard assessment as well as direct/indirect seismic risk evaluation. ...

Еще в разделе: (Показать все результаты (>458) - geo.web.ru/ )

• Pletchov Pavel biography info

THE LABORATORY OF CHEMISTRY AND PHYSICS OF SENSOR AND SEMICONDUCTOR MATERIALS . ... We plan to create a multi-channel analyzer through a detector which comprises a semiconductor in addition to the selective line of resistive type sensors , the sampling system also allowing to carry out a catalytic conversion and concentration of target gases. ... 2008-2014 The Laboratory of chemistry and physics of sensor and semiconductor materials. ...

Еще в разделе: (Показать все результаты (>25) - www.lssm.inorg.chem.msu.ru/ )

• Лаборатория химии и физики полупроводниковых и сенсорных материалов |

FemtoScan 001 - FAQ . Russian version . ... How to build a histogram for a part of image . ... How to copy and print files seen in Quick View . Quick View Parameters and other options . About Macros . ... Choose the command Parameters in the menu View or in the popup menu, which appears after pressing the right button of the Mouse. ... All the images seen in Quick View . ... QuickView] - Legend view, seen on the images of Quick View , number of images ( Show All Images ) . ...

Еще в разделе: (Показать все результаты (>127) - www.spm.genebee.msu.ru/ )

• Hysteresys calibration file generation
• Actions with obtained files
• Macrocommands

The Chair of Mathematical Theory of Intelligent Systems and . ... Research . ... Information Monitoring . ... Search in Databases . ... It is possible this apparatus in an applied investigations on recognition of consecutive information. ... Investigation of possibility of using the additional (non-acoustic) sources of information for speech recognition. ... Investigations of possibilities of usage of methods of fussy logic, optimal control and others in solving of problems of speech recognition. ...

Еще в разделе: (Показать все результаты (>81) - www.intsys.msu.ru/ )

• Intelligent Systems :: Research
• Intelligent Systems :: Research :: :: Demos
• Options

... The methodical recommendation on conducting collective classes is addressed to those teachers who wish to assimilate the collective method of teaching. It contains the essence of the method and peculiarities of its application in practice which were formed on the basis of my personal experience and the experience of the teachers of our school. The didactic materials can help teachers to draw up their own materials on other themes of mathematics. ...

Еще в разделе: (Показать все результаты (>280) - www.mce.biophys.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>21) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

The Department of Talented Youth Affairs and Professional Orientation . ... The Faculty of Journalism of Moscow State University has announced the contest for the design creation of ?Space University? logotype and emblem. ... Criteria for the appraisal of the design: . ... Contest dates: from February 15, 2016 till May 15, 2016. For more information about the contest visit the website: www.journ.msu.ru . ... 2016 - The Department of Talented Youth Affairs and Professional Orientation ...

Еще в разделе: (Показать все результаты (>44) - talant.msu.ru/ )

• editor | The Department of Talented Youth Affairs and Professional Orientation
• News | The Department of Talented Youth Affairs and Professional Orientation |
• admin | The Department of Talented Youth Affairs and Professional Orientation

Prediction of the bacterial promoter regions by DNA electrostatic properties Temlyakova E.A., Sorokin A.A. Institute of Cell Biophysics RAS, Pushchino, Russia, evgenia.teml@gmail.com Electrostatic potential is the only property of a macromolecule that can influence other molecules over distances above 5. ... The database of promoter electrostatic profiles for fast comparison of the DNA sequences to experimentally identified promoters by similarity of their electrostatic profiles has been created. ...

Еще в разделе: (Показать все результаты (>276) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/6.pdf
• OMICS Startup Contest

. Published since 1829 . Editor in Chief: A.S. Severtsov . Editorial Board :V.N. Pavlov (Assistant Editor), Yu.A. Dubrovsky, F.Ya. Dzerzhinsky, R.D. Zhantiev, V.G. Krivenko, M.V. Mina, E.N. Mirzoyan, O. P.Poltaruha, D.D.Sokoloff, V.G. Onipchenko, A.V. Sviridov, G.N. Simkin, M.V. Nilova (Secretary), P.S. Tomkovich.

Еще в разделе: (Показать все результаты (>409) - herba.msu.ru/ )

... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . ... Re: Принимаються заказы на зв. карты Creative X-Fi exteme music ret. n [ re: Panzer ] . ... Re: Принимаються заказы на зв. карты Creative X-Fi exteme music ret. n [ re: Je ] . ...

Еще в разделе: (Показать все результаты (>1751) - www.snto-msu.net/ )

• Re: creative - Public forum of MSU united student networks
• SB Creative ДЕШЕВО - Public forum of MSU united student networks
• Re: Новинки программного обеспечения - Public forum of MSU united student

... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . ... неспешно продам Creative X-Fi Notebook . ... Re: неспешно продам Creative X-Fi Notebook [ re: Turist ] . ... Re: неспешно продам Creative X-Fi Notebook [ re: EVFR ] . ...

Еще в разделе: (Показать все результаты (>3200) - www.fds-net.ru/ )

• Re: creative - Public forum of MSU united student networks
• Thank you guys for creating this room for us! - Public forum of MSU united
• Где скачать Creative Surround Mixer 5.1? - Public forum of MSU united student