... Creation of catalytically active particles from enzymes crosslinked with a natural bifunctional agent--homocysteine thiolactone. ... The current study describes an approach to creation of catalytically active particles with increased stability from enzymes by N-homocysteinylation, a naturally presented protein modification. ... Modification of these proteins concerns the accessible lysine residues and introduces an average of 2-2,5 homocysteine residues per protein monomer. ...

Еще в разделе: (Показать все результаты (>42) - biochem.bio.msu.ru/ )

• Generation of recombinant antibodies and means for increasing their affinity.

... Накопленные данные позволили нам осуществить несколько проектов, в том числе: (1) изучение изменений флоры островов Кемь-Лудского архипелага с 1962 по 2000--2004 гг.; (2) сравнительный анализ флор всех островов с выделением видов-индикаторов групп флор; (3) анализ ареалов распространения видов на островах; (4) сравнительный анализ флор озер региона; (5) пополнение списка флоры и анализ распространения редких видов в изучаемом регионе. ... Созданная база данных постоянно расширяется. ... Флора . ...

Еще в разделе: (Показать все результаты (>6474) - herba.msu.ru/ )

• Bulletin of Moscow Society of Naturalists. Biological series.
• International Journal on Algae Vol.2., No.3. 2000
• Algologia

Published on Department of the Automation for Scientific Research CMC MSU ( http://ani.cs.msu.su ) . ... Created 10 Aug 2008 - 17:36 . ... The preliminary test version of the Automation for Scientific Research Department English edition website has been released. Current content includes general information about the department , list of teachers and researchers , courses of study , contact information and some news. ... Source URL: http://ani.cs.msu.su/en/news-2008-08-10-english-edition . ...

Еще в разделе: (Показать все результаты (>6) - ani.cs.msu.su/ )

Published on Department of the Automation for Scientific Research CMC MSU ( http://ani.cmc.msu.ru ) . ... Created 10 Aug 2008 - 17:36 . ... The preliminary test version of the Automation for Scientific Research Department English edition website has been released. Current content includes general information about the department , list of teachers and researchers , courses of study , contact information and some news. ... Source URL: http://ani.cmc.msu.ru/en/news-2008-08-10-english-edition . ...

Еще в разделе: (Показать все результаты (>13) - ani.cmc.msu.ru/ )

• Department of the Automation for Scientific Research CMC MSU | Computational

pic] European Commission - Press release E7 billion boost for research and innovation will create jobs and growth Brussels, 19 July 2011 - Today Commissioner MАire Geoghegan-Quinn announced nearly E7 billion to kick-start innovation through research. ... Today, Europe is again showing its commitment to putting research and innovation at the top of the political agenda for growth and jobs. ... Research and innovation for cleaner, safer and more efficient transport and mobility will get E313 million. ...

Еще в разделе: (Показать все результаты (>35) - ideas.msu.ru/ )

• http://ideas.msu.ru/docs/EPSS_guide.pdf

... You must have cookies enabled to log in to MediaWiki. ... Retrieved from " http://algcourse.cs.msu.su/teachwiki/index.php/Special:UserLogin " . Special page . 93.180.27.85 . Talk for this IP address . Log in . ... 1-й семестр 2015 г. Материалы по системе ejudge . ... Special pages . ... About MediaWiki . ...

Еще в разделе: (Показать все результаты (>12) - algcourse.cs.msu.su/ )

. Number . Task . Pri . Author . Created By Tool . Created On . Modified On . Completed . Modified By . Assigned To . Link To . Magic . Description

Еще в разделе: (Показать все результаты (>204) - genphys.phys.msu.su/ )

• Active To Do List

... Catalog . ... This web application is brought to you by the following people (in alphabetical order): . Alexey Sergeev, markup issues . Artemy Tregoubenko , JavaScript code . Elena Glushkova, content management . ... We would like to acknowledge the usage of these open source technologies: . Django , web framework . PostgreSQL , database management system . ... SAMP-Webtools , set of JavaScript tools for SAMP-enabled web applications . Developed by the Team . ...

Еще в разделе: (Показать все результаты (>222) - ocl.sai.msu.ru/ )

... Магистерское образование . ... Магистерские программы . ... This is an obligatory course for 1-year students, studying for the magisterial degree ?Open Information systems? and ?Network software?. ... Are researched the most frequently used applied protocols of net security and protocol of creating virtual private nets. ... This is an obligatory course for 1-year students, studying for the magisterial degree ?Program devices of net?. ... Магистратура: master@cmc.msu.ru, 3-й этаж, комната 360, тел. ...

Еще в разделе: (Показать все результаты (>15) - hcs.cmc.msu.ru/ )

• Master program "Enterprise Information Systems" | Магистерское и послевузовское

Big Data has revolutionized biomedicine in areas of drug discovery, diagnostics, clinical trial and personalized treatment. On one hand new analytical methods referred to as "omics technologies" (RNA and DNA sequencing and other technologies) allow to generate unprecedented amount of molecular data for each patient. ... This contest is backed by IT and BioMed Clusters of Skolkovo Foundation and of EMC Corporation. ... Algorithms and software for sequencing and nucleic acid analysis . ...

Еще в разделе: (Показать все результаты (>236) - mccmb.belozersky.msu.ru/ )

... Take latest Pacman and install it : Create somewhere directory software/ and simply untar Pacman there : cd software wget http://physics.bu.edu/pacman/sample_cache/tarballs/pacman-latest.tar.gz tar xzf pacman-latest.tar.gz # It will be created, for example, directory pacman-3.21/ rm -f pacman-latest.tar.gz ln -s pacman-* pacman cd pacman source setup.csh # or setup.sh cd .. ... For instance, if you do pacman -allow tar-overwrite this setting remains as a default until you change it. ...

Еще в разделе: (Показать все результаты (>12) - lhe.sinp.msu.ru/ )

... Russian Pages . CDFE: Home Page . ... Numerical data, graphics, and bibliography . ... description] . Last updated: May 6th, 2014 . ... Last updated: June 15th, 2011 . ... Last updated: . ... Last updated: April 4th, 2015 . ... Last updated: February 25th, 2016 . ... Last updated: September 27th, 2011 . ... Photonuclear Data Index since 1955 . ... Last updated: September 15th, 2015 . ... Last updated: March 22th, 2010 . ... Last updated: March 19th, 2015 . ... Last updated: May 15th, 2002 . ...

Еще в разделе: (Показать все результаты (>4948) - cdfe.sinp.msu.ru/ )

• CDFE provides the major photonuclear databases. Online Services.
• CDFE => Online Services
• Wave Function Value Database

... Fiber optic hidrophones . ... A fiber optic air backed mandrel hydrophone to detect high energy hadronic showers in the water". ( text ) . ... The realization of an optic fiber air backed mandrel hydrophone for frequencies up to 20 kHz". ( text ) . M. Anghinolfi, A. Bersani, A. Calvi, A. Cotrufo, M. Ivaldi, O. Ershova, F. Parodi, D. Piombo, A. Plotnikov and L. Repetto "Measurement of the frequency responsivity of a fiber optic air backed mandrel hydrophone up to 10 kHz in air". ( text ) . ...

Еще в разделе: (Показать все результаты (>23) - antares.sinp.msu.ru/ )

... The given course consisting of lectures and seminars is aimed at teaching our students a whole range of measures, which allow quick and efficient faultfinding, functional testing, reliability testing of a device, find replacement for a faulty component at the modern technological level, fix a device, create a similar device even without the blueprints. ... Programming an unknown board on TestVue Software . ... Functional testing of an unknown board; comparison with the pattern . ...

Еще в разделе: (Показать все результаты (>18) - engineering.phys.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>27) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... About the project . ... Biological information . As part of the project areas we will develop the scientific basis for the creation of infrastructure solutions and knowledge-based platforms for a comprehensive biodiversity study in Russia on the basis of genomic and storage technologies, analysis and exchange of data different types. ... Solution of problems set out in the project area will have the long-term effect in the various fields of science and engineering disciplines in the social sphere. ...

Еще в разделе: (Показать все результаты (>6) - depository.msu.ru/ )

• depozitariy | Living systems depository "Noah's Ark"
• Main grant | depozitariy

SVETKA, a program for analysis of different alignments . Back to the help page . ... Such a feature can look like " Leucine in the position 362 of the alignment of the entire family " and can, in many cases, be a "decision rule" to distinguish sequences from two sides of a tree branch. ... Comparing the alignment with an input tree (the tree may be entered by the user or reconstructed with the WPGMA algorithm), the program detects supporting positions of the alignment for every branch the tree. ...

Еще в разделе: (Показать все результаты (>293) - monkey.belozersky.msu.ru/ )

• NPIDB service
• NPIDB project. Introduction
• About COGs

On-line Data . COHO data . ... PIONEER 10 . ... PIONEER VENUS ORBITER . OMNI data . OMNI Data Set . LASRE data . CORONAS-I (electrons) . CORONAS-I (protons) . ... COSMOS 1686 (electrons) . COSMOS 1686 (protons) . ... Satellite Informations Selector . ... AKEBONO AMPTE Cluster II / Phoenix DMSP Dynamics Explorer (DE) Equator-S FAST Freja GOES-7 GOES-8 Geotail Hawkeye IMAGE (GSFC) IMAGE (SwRI) IMP-8 ISEE Interball LANL MSX Oersted POLAR SAMPEX SOHO UARS Ulysses Voyager WIND . ...

Еще в разделе: (Показать все результаты (>31) - dbserv.sinp.msu.ru/ )

• ULYSSES Online Data Set Selector
• MAGNETOPAUSE CROSSING Online Data Set Selector
• OMNI Online Data Set Selector

Submission Instructions Please read all instructions before completing the form. ... Name: | ... Name Phone | ... No Yes |( ... Are written and dated laboratory records and data available? ... Please provide date of defence or anticipated date of defence. ... Was the invention created using confidential information of a third party? ... result in similar information no longer being supplied to the University when | ... Inventor's signature(s) (if selecting option A, | ... Print Name Signature | ...

Еще в разделе: (Показать все результаты (>44) - innovation.msu.ru/ )

• Start-Up Company Development :: Управление инновационной политики и организации

... 5 Strategies for Business Growth in a World of Customer Networks . ... cheap ray bans . ... cheap moncler . ... 2016 С Днем Победы! ... win 7 ultimate product key Windows 8 key windows 7 key win 7 key windows 7 pro product key win 7 pro product key windows 7 activation key windows 7 ultimate product key windows 7 ultimate serial key windows 7 key online win 7 ultimate key win 7 serial keys Win 7 ultimate key Win 7 ultimate product key windows 7 ...

Еще в разделе: (Показать все результаты (>92) - elana.sinp.msu.ru/ )

• Didn`t suggest we don?t adore determine producer creative designers. We
• cheap michael kors Herbal Antioxidants from the Journal of Orthomolecular
• ralph lauren outlet uk Health Benefits of Soft Water | С Днем Победы!