Theoretical problems of electrical double layer structure on ideally polarized electrodes and reversible adsorption of ions and neutral organic molecules on electrodes are considered, and also the specific features of kinetics of multistage electrochemical processes limited by mass transfer, electron transfer and chemical reaction. ... Acta, 1997, V.42, P.737. ... 1997, V.33, N 10. ... 1997, V.33, N 11. head@elch.chem.msu.ru . ...

Еще в разделе: (Показать все результаты (>24) - www.elch.chem.msu.ru/ )

Выберите категорию обращения: Общие вопросы Отчеты Рейтинги Диссертационные советы Конкурсы Ввод данных Структура организаций Пользователи Проблемы с регистрацией\входом в систему . ... Войти в систему . ... Bashkov A.B. , De_Nicolao G. , Kolmanovskii V.B. , Matasov A.I. в журнале Stochastic Analysis and Applications , издательство Marcel Dekker Inc. ... Bashkov A.B. , Kolmanovskii V.B. , Mao X. , Matasov A.I. в журнале Stochastic Analysis and Applications , издательство Marcel Dekker Inc. ...

Еще в разделе: (Показать все результаты (>5896) - istina.msu.ru/ )

• Werner F. - сотрудник | ИСТИНА - Интеллектуальная Система Тематического
• Shutov I.V. - сотрудник | ИСТИНА - Интеллектуальная Система Тематического
• Zhang Y. - сотрудник | ИСТИНА - Интеллектуальная Система Тематического

Б.П. Леонтьев . ... The very first problem is to select American Educational Materials (AEM), which are of high quality and wide nomenclature. ... Analysis undertaken in [ 1,3 ] revealed time patterns in this process. Time milestones are given to work out original educational and research products, which are based on redesign of AEM and on intercultural experience acquired during participation in JFDP. ...

Еще в разделе: (Показать все результаты (>141) - www.prof.msu.ru/ )

• Problems and Perspectives in Collaborative Russian-American Archaeological
• PROBLEM OF POVERTY IN TAJIKISTAN AND INTERNATIONAL ASSISTANCE
• Fulbright Program in Russia: Prospects and Problems of the Community of...

Research Interests . Main current projects: . The Continuous Wavelet Transform based on the solution of Partial Differential Equations and its applications . ... Mean-field description of Kinetic Aggregate's Growth and Disease Spead including Anomalous Diffusion. ... It is based on the reducing of this integral transform to the exact analytical representation as the series of the Bessel and Struve functions multiplied by the wavelet coefficients of the input function. ...

Еще в разделе: (Показать все результаты (>75) - chaos.phys.msu.ru/ )

... The applied mathematics (with Honors), Kazan State University, Kazan, Russia (USSR), 1980. nd Alexander Lazarev Research Interests Discrete optimization: combinatory problems, modeling, decomposition algorithms, applications to production planning and scheduling. ... Kazan, Publishing house of the Kazan mathematical society, 1998. - 285 p. Lazarev A.A., Gafarov E.R. Scheduling Theory. ... Computer centre of the Russian Academy of Sciences - 2006. - 134 p. Lazarev A.A., Gafarov E.R. Scheduling Theory...

Еще в разделе: (Показать все результаты (>35) - physcontrol.phys.msu.ru/ )

• Features
• Featured Articles
• Главная

A very important stage in a story of formation of any new science is the shift from discussion of situation which are possible but do not occur in practice due to some reason to recognition of real phenomena of interest. ... We suggest to consider computer viruses as this new specific form of life which is coming in the contact with our form of life. ... Computer life has been created by human being, the role of independent evolution of computer viruses seems to be still negligible. ...

Еще в разделе: (Показать все результаты (>232) - lnfm1.sai.msu.ru/ )

• http://lnfm1.sai.msu.ru/SETI/koi/bulletin/2/pril3.html
• Труды Ширмина Г.И.
• Problems

Multigrid method application to solve the tire rolling problem / K. A. Lopukhin, S. V. Sheshenin. Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika. 2010. ... This paper studies one geometric multigrid method in a rolling tire problem, finding components that make it reasonably effective for solving systems that are large enough for real simulation. ... Key words : multigrid method, tire simulation. ...

Еще в разделе: (Показать все результаты (>324) - vestnik.math.msu.su/ )

• Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika Вестник

... 07.04.2016 (Thursday) Session 1 10:00-10:20 10:20-10:40 10:40-11:00 11:00-11:20 11:20-11:40 ­ ­ ­ ­ ­ (chairman ­ M. Stynes) N. Kopteva V. Andreev H.-G. Roos S. Franz, H.-G. Roos A posteriori error estimates for singularly perturbed reactiondiffusion problems on anisotropic meshes. ... Numerical solution of a singularly perturbed initial-boundary value problem with a Neumann condition for a parabolic equation. ... Boundary layer solutions to time-periodic singularly perturbed parabolic problems. ...

Еще в разделе: (Показать все результаты (>10) - math.phys.msu.ru/ )

• Department of Mathematics, Faculty of Physics, Lomonosov MSU

... Ph.D., Professor, Deputy Dean, School of Public Administration, Lomonosov Moscow State University, Moscow, Russian Federation. ... In the article organizational difficulties are analyzed, based on their potential consequences for an organization, within the frameworks of two closely related by separate disciplines: problem management and crisis management. ... Strategic planning, stakeholders, problems, strategic break, crisis, problem management, crisis management, social responsibility of business...

Еще в разделе: (Показать все результаты (>311) - ee-journal.spa.msu.ru/ )

... Special features of different systems . ... MPI makes it relatively easy to write portable parallel programs. ... There are two basic types of parallel environments: parallel computers and clusters of workstations. ... The MPICH implementation is designed to hide these differences behind the mpirun script; however, if you need special features or options or if you are having problems running your programs, you will need to understand the differences between these systems. ... Центры . ...

Еще в разделе: (Показать все результаты (>366) - www.parallel.ru/ )

• Problems in testing | PARALLEL.RU - Информационно-аналитический центр по
• Problems configuring | PARALLEL.RU - Информационно-аналитический центр по
• Problems linking C programs | PARALLEL.RU - Информационно-аналитический центр

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>11) - mouse.genebee.msu.ru/ )

Series on Stability, Vibration and Control of Systems, Series A - Vol. ... MULTIPARAMETER STABILITY THEORY WITH MECHANICAL APPLICATIONS . ... This book deals with fundamental problems, concepts, and methods of multiparameter stability theory with applications in mechanics. ... Introduction to Stability Theory . ... Read Full Review . ... Since Bolotin's pioneering book on nonconservation problems on the theory of elastic stability, not many books appeared at such a high level, such as this one. ...

Еще в разделе: (Показать все результаты (>30) - mailybaev.imec.msu.ru/ )

... Previous message: [RU-NGI] Пропала часть ldap информации . ... Нужна просто информация о положении дел) -------- Forwarded Message -------- Subject: Persistent problems with some russian sites Date: Mon, 27 Oct 2014 07:46:55 +0100 From: Giuseppe Bagliesi Giuseppe.Bagliesi at cern.ch To: Olga Kodolova kodolova at mail.cern.ch , Sergei Shmatov sergei.shmatov at cern.ch , Grigory Safronov safronov at cern.ch , Elena Tikhonenko Elena.Tikhonenko at ...

Еще в разделе: (Показать все результаты (>1157) - theory.sinp.msu.ru/ )

• The problem
• [RU-NGI] nagios problem
• [RU-NGI] dpns problem

... САО РАН, Буково, 1-8 ноября 1996 г. SAO , Bukovo, November 1-8, 1996. ... Условия задач, 8-10 класс Problems to solve, 8-10 Form Text of these problems is available in English too. ... Какие слабейшие звезды можно наблюдать на этом телескопе глазом? ... Условия задач, 9-12 класс Problems to solve, 9-12 Form Text of the problem is available in English too. ... 28 Aug 89 . ... Наблюдательный тур (внеконкурсное задание), 9-12 класс Text of the problem is available in English too. ...

Еще в разделе: (Показать все результаты (>20) - www.issp.ac.ru/ )

• Institutes of Chernogolovka
• II International Astronomy Olympiad, Problems to solve
• Problems of the 1-st International Astronomy Olympiad

... Scientific directions . ... The research of the department of General Problems of Control has taken four major directions, each of which has several branches. ... general Lagrange principle, problems of convex analysis and methods of duality in the theory of extremal problems . ... free-boundary problems . ... Optimization, optimal control, numerical methods and questions of applied mathematics: . ... 119992 Moscow, GSP-1, Leninskie Gory, MSU, mechanics and mathematics department, OPU, Room 13-14 . ...

Еще в разделе: (Показать все результаты (>130) - new.math.msu.su/ )

• Seminars of the department | Department: General Problems of Control. Faculty
• Current staff list | Department: General Problems of Control. Faculty of
• Graduate study | Department: General Problems of Control. Faculty of Mechanics

Singularly p erturb ed problems with b oundary and internal layers Adelaida B. Vasilieva Lomonosov Moscow State University, Moscow , 119991, Russia e-mail: ABVAS@phys.msu.ru Valentin F. Butuzov Lomonosov Moscow State University, Moscow , 119991, Russia e-mail: butuzov@phys.msu.ru Nikolay N. Nefedov Lomonosov Moscow State University, Moscow , 119991, Russia e-mail: nefedov@phys.msu.ru Nonlinear singularly ...

Еще в разделе: (Показать все результаты (>41) - pont2008.cmc.msu.ru/ )

• http://pont2008.cs.msu.ru/files/en/abstracts/Gaifullin.pdf
• Program Международная конференция Дифференциальные уравнения и топология ,

Documentation on Firefly v. 8.0.0 numerical gradient features . The numerical gradient code is activated as follows: . ... The primary purpose of this code is to allow computations normally requiring analytic energy gradients, to be performed using those QC methods for which analytic gradients are not yet programmed. ... The numerical gradients code is tightly integrated into Firefly and can be used anywhere where the analytical energy gradients are required by default. ... The default is 2. ...

Еще в разделе: (Показать все результаты (>95) - classic.chem.msu.su/ )

• Firefly Home Page
• PC GAMESS/Firefly DOCUMENTATION - running in parallel under Windows using
• Notes on some of Firefly's specific features

COMPUTER DESIGN OF HETEROCYCLIC RING-OPENING REACTIONS. ... Since the cleavage of ring bond requires appearance of new bond either between th e (endo) atoms of initial cycle, or between initial cycle and external (exo) group, the first case is treated as endoopening, and the another as exo-opening: Endo-Ring Opening Exo-Ring Opening © 1995 American Institute of Physics 75 7 758 Heterocyclic Ring-Opening Reactions General Methodology and Algorithms 1. ... RULE FOR ENDO-TYPE RJNG OPENING. ...

Еще в разделе: (Показать все результаты (>174) - www.chem.msu.ru/ )

THE LABORATORY OF CHEMISTRY AND PHYSICS OF SENSOR AND SEMICONDUCTOR MATERIALS . ... New approaches to the synthesis of colloidal quantum dots on InP based biomarkers to create . ... For this it is necessary to carry out the replacement of stabilizing shells . ... To replace the membranes using standard samples CT InP, MA stabilized , since the latter is quite labile ligand , as well as samples of heterostructures InP / ZnSe with two monolayers Accrued zinc selenide and also stabilized myristic acid. ...

Еще в разделе: (Показать все результаты (>55) - www.lssm.inorg.chem.msu.ru/ )

Maximum RPM: Taking the Red Hat Package Manager to the Limit . ... At the time Red Hat started work on their Linux distribution, there were a number of package management systems in use, each with a different approach to making package management easier. ... RPP was used in the first Red Hat Linux distributions. ... While Red Hat was busy with RPP, another group of Linux devotees were hard at work with their package management system. ... This one would be called the Red Hat Package Manager, or RPM. ...

Еще в разделе: (Показать все результаты (>399) - uneex.lorien.cs.msu.su/ )

• Support - Frequently Asked Questions - Apache HTTP Server
• Relocatable Wrinkles: Things to Consider
• Frequently Asked Questions - Apache HTTP Server