... Algorithm & . Format requirements . ... SDPsite is a tool for identification of protein active and other functional sites, based on spatial clustering of SDPs (specificity-determining positions, described here ) with CPs (conserved positions). ... Mapping predictied positions onto structure and construction of the best cluster . ... The input data of the algorithm are a multiple protein alignment divided into specificity groups . ... is called statistical significance of the set of k* positions . ...

Еще в разделе: (Показать все результаты (>13) - bioinf.fbb.msu.ru/ )

• SDPlight
• Input Formats
• SDPpred

... Spectral and kinetic parameters of phosphorescence of triplet chlorophyll a in the photosynthetic apparatus of plants. ... Spectral and kinetic parameters and quantum yield of IR phosphorescence accompanying radiative deactivation of the chlorophyll a (Chl a) triplet state were compared in pigment solutions, greening and mature plant leaves, isolated chloroplasts, and thalluses of macrophytic marine algae. ... This parameter is stable in leaves of different plant species. ...

Еще в разделе: (Показать все результаты (>48) - biochem.bio.msu.ru/ )

... Data . ... Services . ... Solar energetic particles . ... N -d SW Conditions : Time profiles of the key geomagnetic ( Ap and Dst indices), solar wind (velocity V , density n and temperature T ) and IMF ( B , Bx , By , Bz in GSM) parameters observed in the N day vicinity of the geomagnetic disturbed day. N -d Map of Solar Events : Map of solar surface events occurred within N day vicinity of the moment when the solar wind expansion (which causes the geomagnetic event) started. ... WIND . ...

Еще в разделе: (Показать все результаты (>37) - smdc.sinp.msu.ru/ )

• Space monitoring data center
• Scientific services - Space monitoring data center
• COSRAD model - Space monitoring data center

... This gropup of options allows You to change the following speech recording parameters: . ... This gropup of options allows You to change the following parameters of linear prediction: coefficients calculation: . ... This gropup of options allows You to change the following speech processing parameters: . ... This gropup of options allows You to change the following speech recognition parameters: . ... This gropup of options allows You to change the following speech detection parameters: . ...

Еще в разделе: (Показать все результаты (>64) - www.intsys.msu.ru/ )

• Options
• Intelligent Systems :: Research :: :: Articles

... Publications . ... Laboratory of Mathematical Methods of Image Processing . Chair of Mathematical Physics . ... Algorithms for calculating parameters of virtual scenes in computer vision tasks . Publication type . Conference paper . ... 21-th International Conference on Computer Graphics GraphiCon'2011 . ... Title = {Algorithms for calculating parameters of virtual scenes in computer vision tasks}, . ... BookTitle = {21-th International Conference on Computer Graphics GraphiCon'2011}, . ...

Еще в разделе: (Показать все результаты (>158) - imaging.cmc.msu.ru/ )

... Distribution of neutron counting rate near the Earth surface is studied in two directions - to the Earth and from it - according experimental data, obtained in Moscow in 1996. ... We suppose that logarithmically normal distribution describes an input of the Earth crust into the neutron flux. ... Usual periods . ... Full approximation of thermal neutrons distribution near the Earth crust is presented as a sum of two functions - Poison distribution and logarithmically normal distribution. ...

Еще в разделе: (Показать все результаты (>103) - www.kosmofizika.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>11) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

A new Monte Carlo method of the numerical integration "Superposing Method" T.Kaneko and K.Tobimatsu * KEK, Tsukuba Japan *Kogakuin University, Tokyo Japan 1. Basic idea Division method Random Sampling Superposing method Regions are deterministic ACAT2002 in Moscow, Superposing method TK & KT Regions are randomly taken 2 The method is more flexible than usual division method in choosing a shape for sub -region. ... ACAT2002 in Moscow, Superposing method TK & KT 6 3. ...

Еще в разделе: (Показать все результаты (>62) - acat02.sinp.msu.ru/ )

• http://acat02.sinp.msu.ru/presentations/morhac/ACAT2002_Morhac_ID142.pdf
• http://acat02.sinp.msu.ru/poster-sessions.html
• http://acat02.sinp.msu.ru/presentations/huhlaev/Metamake.doc

... Voronov, Vasiliy. Scalability and efficiency of parallel power grid simulations on massively-parallel platforms (submitted). ... 2009. ... Voronov, Vasiliy and Popova, Nina. ... Conference proceedings 2010. ... Abstract Book of SIAM Conference on Parallel Processing for Scientific Computing (SIAM PP10). ... Proceedings of the International Conference on Parallel Computing (ParCo-2009). ... IEEE Computer Press. ... Pozdneev, Alexander and Popova, Nina and Voronov, Vasiliy. ...

Еще в разделе: (Показать все результаты (>4) - angel.cmc.msu.ru/ )

... DEPRON device (Dosimeter of Electrons, PROtons and Neutrons) is intended for the measurements ofљ the absorbed doses and linear energy transfer spectra from high-energy electrons, protons and nuclei of space radiation, and for detecting of thermal and slow neutrons flux. ... Charged particles dosimeter based on semiconductor detector . ... For each detected particle an amplitude of impulse proportional to the energy lost by the particle in the detector?s track sensitive volume is registered. ...

Еще в разделе: (Показать все результаты (>24) - lomonosov.sinp.msu.ru/ )

• ELFIN-L | Университетский спутник "Ломоносов"
• Information unit (BI) | Университетский спутник "Ломоносов"
• TUS | Университетский спутник "Ломоносов"

Welcome , Registration , and other StartingPoints ; TWiki history & Wiki style; All the docs.. ... Line: 1 to 1 . ... Changed: . ... It should correspond to the format of the format parameter. ... Topic:* | ... FAQ\:[\n\r]*([^\n\r]+).*) [[$topic][Answer.. ... SEARCH{ "\.*" scope="topic" regex="on" nosearch="on" nototal="on" order="modified" reverse="on" format="| [[$topic]] | ... SEARCH{ "\.*" scope="topic" type="regex" nosearch="on" nototal="on" order="modified" reverse="on" format="| [[$topic]] | ...

Еще в разделе: (Показать все результаты (>37686) - dualopt1.cmm.msu.ru/ )

• IncludeTopicsAndWebPages - TWiki - TWiki - (printable)
• VarURLPARAM - TWiki - TWiki
• VarURLPARAM - TWiki - TWiki - (printable)

Development of new approaches to the analysis of ring shapes in organic molecules and the description of electronic distribution (atomic charges) and halogen bonding in the framework of forcefield model for rapid estimation of intra- and intermolecular interaction energies in molecular mechanics, molecular dynamics and docking methods . Forcefield is a model and a set of parameters for theoretical description of intra- and intermolecular interactions. ... 2016 Laboratory of Medicinal Chemistry ...

Еще в разделе: (Показать все результаты (>6) - qsar.chem.msu.ru/ )

... Applications of Molecular Mechanics to Metal Complexes" . ... Molecular mechanics study of the mixed-ligand lanthanide complexes using Gillespie-Kepert model . ... Within MM-GK, the same parameters are applicable to complexes of different coordination numbers/polyhedra. ... Gillespie-Kepert model . ... Using derived computational parameters, we calculated the geometry of 39 lanthanide ion nonaaqua complexes, 6 octaaqua complexes and 18 beta- diketonate and aqua-beta-diketonate complexes. ...

Еще в разделе: (Показать все результаты (>31) - analyt.chem.msu.ru/ )

• Molecular Mechanics Calculations of beta-Diketonate, Aqua, And
• The Molecular Mechanic Approach to Coordination Compounds: Force Field Based on

Abiotic parameters of the White sea islands (ZIP, xls inside) . Floristic changes on the Kem-Ludy islands: thesis and poster (PDF) . Floristic lists for the White sea islands (ZIP, xls inside) . ... PDF) . Lost and found: short-term dynamics of the ?ora on 100 small islands in the White Sea (PDF) . Photos of the White sea islands . ... The analysis of vascular plants' distribution on the islands of Kiv gulf, Tchupa gulf and Keret' archipelago . ...

Еще в разделе: (Показать все результаты (>186) - herba.msu.ru/ )

• Flora of lakes in Chupa gulf environs

Program ODF3 is elaborated for numerical simulation of the EPR spectra and determination of the spectra parameters by fitting procedure. ... The examples of results obtained using ODF3 are presented in chapter "Simulation of rigid limit and slow motion EPR spectra for extraction of quantitative dynamic and orientational information" (in "Nitroxides - Theory, Experiment and Applications", ISBN 979-953-307-1090-0.) ... Copyright (C) Chemisty Department of Moscow State University . ...

Еще в разделе: (Показать все результаты (>147) - www.chem.msu.ru/ )

• THE EFFECT OF CATALYST ON INTERMOLECULAR HETEROGENEITY DISTRIBUTION IN

... Preliminary Analysis of the Self Similarity of the Aftershocks of the Japanese Earthquake on March 11, 2011 V. S. Zakharov Faculty of Geology, Moscow State University, Moscow, 119991 Russia e mail: vszakharov@yandex.ru, zakharov@dynamo.geol.msu.ru Received October 11, 2011 Abstract--The quantitative parameters of the self similarity of the aftershocks of the Japanese earthquake on March 11, 2011 were obtained. ... Most aftershock hypocenters were located at a depth of 20­50 km. ...

Еще в разделе: (Показать все результаты (>22) - dynamo.geol.msu.ru/ )

• http://dynamo.geol.msu.ru/personal/vsz/papers/Zakharov_2011_2_eng.pdf
• Summaries of articles
• Доклады В.С.Захарова

... Parameters . ... Natural Satellites Data Center. Parameters and constants . ... Satellites of Mars . Satellites of Jupiter . Satellites of Saturn . Satellites of Uranus . Satellites of Neptune . Satellite of Pluton . Masses of satellites . Dimensions of satellites . Photometric parameters of satellites . Rotational parameters and poles . Orbital parameters of the outer satellites of Jupiter, Saturn, Uranus and Neptune . ...

Еще в разделе: (Показать все результаты (>18) - www.sai.msu.ru/ )

. G. P. Shpenkov, L. G. Kreidik. Conjugate Parameters of Physical Processes and Physical Time (PDF-file, 370 Kb) [distributed 25.10.2009] . G. P. Shpenkov, L. G. Kreidik Dynamic Model of Elementary Particles and Fundamental Interactions (PDF-file, 240 Kb) [distributed 05.10.2009] .

Еще в разделе: (Показать все результаты (>484) - chronos.msu.ru/ )

• Шпенков Г.П. (G. P. Shpenkov)
• O.S.Razumovsky. Models of Time in Physics and Cosmology
• Quantitative methods of ecological control:

... J.K. Krylov . In the monography by R. Koehler [1] there was described a very interesting effect of the words' average length oscillation as a function of their frequency of use (according to the data from a representative frequency dictionary). ... In this context, further the Koehler's effect will be definied as polymodal character of the dependence of the conditioned average in cases of two-dimencional distributions of any linguistic nature. ...

Еще в разделе: (Показать все результаты (>55) - old.philol.msu.ru/ )

• MSU-LGCLL:: Krylov J.K.- Three Laws of Fiction Prosaic Texts Organization
• Large transportation networks with finite-dimensional state space. Asimptotic
• MSU-LGCLL:: Papers submitted to QUALICO-94

A GENETIC ALGORHYTM FOR OPTIMIZING A NEURAL NETWORK CAPABLE TO LEARN FOR FOOD SEARCHING IN A RADIAL MAZE Budilova E.V., Chepurnova N.E., Chepurnov S.A, Teriokhin A.T. M.V.Lomonosov Moscow State University, Dept. of Biology. ... The upper platform has a hole in the middle and several radially directed tubular canals ("arms") each of which can contain a peace of food and has doors opening only in the centrifugal direction. ... The task of the animal is to visit only those arms which contain food. ...

Еще в разделе: (Показать все результаты (>32) - ecology.genebee.msu.ru/ )

• http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2000_Longev_JEvolBio.pdf