... создается некое подобие 3-х мерного пространства Слова показа и и отображены таким же способом. -- param name =example_object_0 value = pltext step =20 font =Verdana:28,3 value =%АППЛЕТ% link = exline :0 color =#009999 param name =example_object_1 value = pltext step =20 shifts=2,2 font =Verdana:28,3 value =%АППЛЕТ% link = ...

Еще в разделе: (Показать все результаты (>15) - adept.srcc.msu.ru/ )

• http://adept.srcc.msu.ru/adept/java/applet_book/layer/layer4text1.htm
• http://adept.srcc.msu.ru/adept/java/applet_book/cursor/cursor1text1.htm
• http://adept.srcc.msu.ru/adept/java/applet_book/layer/layer1text1.htm

Described below are two methods for preparing input files with basis sets and ECPs which are not currently built in. ... Put basis sets and ECPs in directories (called here def2_svp_BAS and def2_ecp_ECP but you can call them whatever you want) and copy them to the Firefly directory. ... Both methods can also be used for preparing gamess (us) files - the check runs may not terminate properly due to certain keywords, but a useable file called 'input' is normally generated. ...

Еще в разделе: (Показать все результаты (>74) - classic.chem.msu.su/ )

• Potential Energy Surfaces with PC GAMESS/Firefly
• PC GAMESS/Firefly DOCUMENTATION - running in parallel using LAM/MPI
• PC GAMESS/Firefly DOCUMENTATION - Cube files

Выберите категорию обращения: Общие вопросы Отчеты Рейтинги Диссертационные советы Конкурсы Ввод данных Структура организаций Пользователи Проблемы с регистрацией\входом в систему . Тема обращения: . ... Войти в систему . ... Arakcheeva A., Chapuis G. , Petricek C. , Morozov V. в журнале Acta Crystallographica Section B: Structural Science , издательство Blackwell Publishing Inc. ... Создать обращение в службу поддержки пользователей . ...

Еще в разделе: (Показать все результаты (>2257) - istina.msu.ru/ )

• Golunova M.A. - сотрудник | ИСТИНА - Интеллектуальная Система Тематического
• Khlobystov Andrei N. - сотрудник | ИСТИНА - Интеллектуальная Система
• Martinez C. - сотрудник | ИСТИНА - Интеллектуальная Система Тематического

Diploma thesis abstract. ... In this work the propagation and nonlinear interactions of nanosecond laser pulses in microstructure fibers are studied. Experiments presented in this diploma demonstrate the capability of hollow photonic crystal fibers to provide nanosecond laser pulses with a flow more than 500 J/cm2. Efficiency of nonlinear spectroscopy methods by the example of Coherent antiStokes Raman scattering was studied. ...

Еще в разделе: (Показать все результаты (>86) - ofvp.phys.msu.ru/ )

• http://ofvp.phys.msu.ru/en/science_education/diploma/annot/2007/Smirnova_Shkurinov_en.pdf

NUCLEAR ASTROPHYSICS Yu. ... ейСЦгъ кДлтакьыфЦвль ЗлЦгЦззйв 68 © иВМЛУМКНВ,Л~ ы.щ., 1998 1965 "", , , , 3 . ... иЦзайзЬдЦЗау ы.щ. ьСЦкзДь ДлнкйоабадД 69 100 (1012 ), , . ... 100 1 1 . ... 1, , , 1 1010 . ... 40 (1,3 109 ) 87 232 40 Ar, Sr, Pb, Rb (4,8 1010 ) 87 Th (1,4 1010 ) U (4,5 109 ) 208 206 238 Pb]. ... 238U - 238, r- - 242, 246 250. 250 238U. 235U 238U, r- . ... s-, ( 1,64 1,0 ( 235 C 15 + N 1,0 (, ) U/ 238 U) "" CNO "" CNO 238 235 , 235U/ 238U = 0,29 U/ 238U = 0,65 235U/ 238U = 1,21 109 . ...

Еще в разделе: (Показать все результаты (>217) - nuclphys.sinp.msu.ru/ )

• http://nuclphys.sinp.msu.ru/conf/lpp14/190809/Krasnikov.pdf
• http://nuclphys.sinp.msu.ru/persons/VEKSLER/veksler100/reports/reports/Toneev_100VIV.11.10.07.pdf
• http://nuclphys.sinp.msu.ru/mirrors/2000_5c.pdf

... Home > Scientific laboratories > IM . ... The Laboratory of Industrial Mathematics (LIM) headed by Professor V.M. Goloviznin was established in the Faculty of Computational Mathematics and Cybernetics (CMC) of Lomonosov Moscow State University in 2011. ... In the area of energy and space, examples of topical engineering problems LIM is involved in, include the numerical simulation of new-generation atomic plants and computational aeroacoustics. ... Source URL: http://en.cs.msu.ru/laboratories/im . ...

Еще в разделе: (Показать все результаты (>89) - en.cs.msu.ru/ )

• Laboratory of Industrial Mathematics | CMC MSU

... Mathematical Treatment of Exhaust Systems with Acoustic Properties Using Mathlie I. Algorithms . ... The first part of the two talks is concerned with ? algorithms applied to examples origin from an ? exhaust system. ... The model equations are determined ? by conservation of mass, momentum and energy. In addition there exists an equation of state ? for the ideal gas system. ... Applying computer algebra to ? these model equations, we demonstrate that ? solutions can be derived. ...

Еще в разделе: (Показать все результаты (>176) - acs366.phys.msu.su/ )

cAMP-induced conformational changes of Protein Kinase A I A-domain O. N. Rogacheva, V. E. Stefanov St. Petersburg State University, Universitetskaya nab. ... In the end, we presented the conformational transition of the A-domain in the form of a partly deterministic sequence of six events: 1) B 2) C1, D1, 3) E, 4) C2[D2], F, 5) G. The sequence of the items of this scheme corresponds to the process of the conformational transition in time. ...

Еще в разделе: (Показать все результаты (>160) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/6.pdf
• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/179.pdf
• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/198.pdf

LangueDOC . ... Languages . ... Archi . ... The phonetic system of Archi is very rich, and the writing systems that are familiar to Archi speakers (Russian cyrillic and Avar cyrillic) are not sufficient for recording all sounds of the language. ... Kibrik et al. 1977] ? the notation used in this dictionary is given in the comparative table below under the label "1977"; [Kibrik, Kodzasov 1990]), but they were too difficult for the Archi speakers to learn and therefore remained inaccessible to them. ...

Еще в разделе: (Показать все результаты (>194) - www.philol.msu.ru/ )

• LangueDOC :: Tools :: Text conversions

... NGOs: The Carriers of Globalization? ... Globalization process: transformation of territory and territoriality; . NGOs as players in the transformation of territoriality; . Networks of CABs in Eastern Europe as an example of deterritorialization of social space. Globalization is a process of reshaping social space and individual perception of the world through transforming the notion of territoriality from state-restricted to transnational space. ...

Еще в разделе: (Показать все результаты (>61) - www.prof.msu.ru/ )

• HUMAN RIGHTS AND DEVELOPMENT
• About the importance of founding teleecommunication centres in developing areas
• Conflict Transformation, Ngo And Networking

QUANTUM STOCHASTIC PROCESSES This course is for 4-5th year and graduate students. ... It is dedicated to systematic account of Quantum Stochastic Processes right in the form they are actually used in theoretical calculations of Quantum Open Systems. ... LECTURE 2. ... Open systems and quantum stochastic processes. Mathematical definition of an open system and quantum stochastic process. ... Markovian quantum stochastic processes. Formal definition of quantum markovian stochastic process. ...

Еще в разделе: (Показать все результаты (>75) - qilab.phys.msu.ru/ )

... Alignment Sequence . Include picture . No Picture Only Structure Structure and BP numbers Structure and Stem Energy Full Picture . Sequence name . Alignment OR sequence (without name). The usage of Alignment is strongly recommended. Alignment example: . ... ANMF CGCGGGGTAGAGCAGCCTGGTAGCTCGTCGGGCTCATA AQTRNF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAA BGTRF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAT ANMF ATCCTCTCCCCGCC---- AQTRNF ATCCGCCTCCCGGCACCA BGTRF ATCCGCCTCCCGGCACCA . ...

Еще в разделе: (Показать все результаты (>164) - www.genebee.msu.ru/ )

• Screening pattern or alignmemt against PROTEIN databank
• AliComp - GeneBee Alignments Comparison - Advanced
• GeneBee service

Thursday, June 24th, 2010 . ... Wednesday, June 16th, 2010 . На сайт добавлен пакет Lightbox 2.04 (http://www NULL .huddletogether NULL .com/projects/lightbox2/) (by Lokesh Dhakar) для отображения графики с дополнительными визуальными эффектами: . ... You are currently browsing the Лаборатория лазерной интерферометрии blog archives for June, 2010. ... Наши публикации . ... Публикации за 2011 . Публикации за 2012 . ... Лаборатория лазерной интерферометрии is proudly powered by WordPress . ...

Еще в разделе: (Показать все результаты (>4) - geo.sai.msu.ru/ )

• Lightbox 2 Лаборатория лазерной интерферометрии
• site lightbox Лаборатория лазерной интерферометрии
• Uncategorized Лаборатория лазерной интерферометрии

... Software . Laboratory of Mathematical Methods of Image Processing . ... Available options: -sigma - (mandatory) set blur parameter for the input image , range: 1.0 to 20.0 - power - set warping power , range: 0.0 to 5.0, default value is 1.0 -1d - apply one-dimensional algorithm (faster but lower quality) basicedges - detect basic edges - edges good for artifact analysis -scale - set scale parameter, range: 1.0 to 20.0, default value is 4.0 gaussblur - blur input ... warp.png . ...

Еще в разделе: (Показать все результаты (>82) - imaging.cmc.msu.ru/ )

ChangeLog for snakes # # Generated by Trac 0.12.5 # 04/11/16 22:55:00 Mon, 20 Dec 2010 14:01:39 GMT Daniil Alexeyevsky me.dendik@тАж [134:8e75e931bfd2] * snakes / example.snake ( modified ) example.snake : better rules for chasing enemy tail Mon, 20 Dec 2010 11:57:44 GMT Daniil Alexeyevsky me.dendik@тАж [121:06e4b4ea7596] * snakes / example.snake ( modified ) * ...

Еще в разделе: (Показать все результаты (>383) - kodomo.cmm.msu.su/ )

• http://kodomo.cmm.msu.su/trac/snake/log/snakes?format=changelog&rev=360c297c05f3577ca730ecaf86131163456f6b73&limit=100&mode=stop_on_copy
• http://kodomo.cmm.msu.su/trac/snake/log/snakes?format=changelog&rev=138%3A416418c9aaef&limit=100&mode=stop_on_copy
• http://kodomo.cmm.msu.su/trac/snake/log/snakes?format=changelog&rev=416418c9aaefbd75f3451a63f12d0ab8af3b89f3&limit=100&mode=stop_on_copy

... Alechin , Vasilii Vasilievich (1884-1946) . Alexeev , Eugeni Borisovich . Bobrov , Andrej Evgenievich . ... Ehrhart , Friedrich (1742-1795) . Goldbach , Carl Ludwig (1793-1824) . ... Juzepczuk , Sergei Vasilievich (1893-1959) . Karavaev , Mikhail Nikolaevich ( 1903-1992 ) . Khokhrjakov , Andrej Pavlovich (1933-1998) . Kuvaev , Vladimir Borisovich . ... Linnaeus , Carl, fil. ... Sokoloff , Dmitry Dmitrievich . ... Tzvelev , Nikolai Nikolaevich . ... Phone/fax: 7 (095) 939-2777 . ...

Еще в разделе: (Показать все результаты (>113) - herba.msu.ru/ )

• INTERNATIONAL SYMPOSIUM
• Alders in the European Russia
• The employment of quantitative methods for the lake ecosystem research

. Moscow State University . INTERNATIONAL CONFERENCE . H YDRODYNAMIC I NSTABILITY AND T URBULENCE . February 24 ? March 02 , 2008 . Moscow, Russia . Call For Papers Информационное письмо . Author instructions . Abstract example Paper example . Location (More information) . Conference Program Posters . E-mail : gertsens@imec.msu.ru . Institute of Mechanics, Lomonosov Moscow State University . Aerodynamical Installations . Moscow Sights & Attractions

Еще в разделе: (Показать все результаты (>14) - hit-conf.imec.msu.ru/ )

. ? mfs = 0.7 cm . ? hsfa = 0.8 cm . D sun_slit = F ? (2?) [rad] [cm] . (F mfs = 13500 mm, F hsfa = 35000 mm) . A procedure for calibrating fits images from Ondrejov Multichannel Flare Spectrograph .

Еще в разделе: (Показать все результаты (>107) - lnfm1.sai.msu.ru/ )

• Manpage of FITSHDR
• FITShdr: INSTALL
• IDL programs

Название статьи И.О. Фамилия11,a, И.О. Фамилия22,b 1 Название института и полный адрес, например: Московский государственный университет имени М.В.Ломоносова, физический факультет, кафедра общей физики. ... Title in English I.O. Pervyiavtor1,a , I.O. Vtoroiavtor2,b 1 Название института и адрес на английском языке, например: Department of [.. ... Moscow 119991, Russia. 2 Название института и адрес на английском языке, например Sternberg State Institute of Astronomy, Moscow State University. ...

60. XAFS Publication Database search form