Preliminary results of astroclimate parameters measurements at the Sternberg 2.5m telescope installation site V.Kornilov, N.Shatsky, S.Potanin, O.Voziakova, B.Safonov Moscow, 2008 Acknowledgements A.Belinskiy M.Kornilov A.Tokovinin M.Kuznetsov P.Kortunov E.Gorbovskoy SAI administration some SAI students Pulkovo solar station (KHSS) staff RFBR support MAVEG Gmbh Why to study optical turbulence and some other relevant ... Mean seeing by DIMM data for this night is 1''5. ...

Еще в разделе: (Показать все результаты (>25) - curl.sai.msu.ru/ )

... We offer the automated training systems TCM and TNM, intended for support of rates of computer modelling and numerical methods, developed in the Bryansk state university. ... Systems TCM and TNM can be used both on laboratory researches, and for the organization of independent work of students. ...

Еще в разделе: (Показать все результаты (>13487) - www.mce.biophys.msu.ru/ )

• Calculating experiment and problems of nonlinear dynamics in computer practical
• Books : Enqlish for Computer Science Students

Theoretical problems of electrical double layer structure on ideally polarized electrodes and reversible adsorption of ions and neutral organic molecules on electrodes are considered, and also the specific features of kinetics of multistage electrochemical processes limited by mass transfer, electron transfer and chemical reaction. ... Acta, 1997, V.42, P.737. ... 1997, V.33, N 10. ... 1997, V.33, N 11. head@elch.chem.msu.ru . ...

Еще в разделе: (Показать все результаты (>17) - www.elch.chem.msu.ru/ )

Mathematical modeling of biophysical processes in living cells and tissues . duration 6 months . ... 7(095) 939-26-12, Fax: +7(095)939-31-13, Email: romanov@yumr.phys.msu.ru . ... Interaction of femtosecond laser pulses with plasmas of modified targets . ... Theoretical investigations of polarization self-action and wave-interaction effects in nonlinear optics. ... Alexander V. Priezzhev, Associate Professor, Candidate of Sciences (physics and mathematics), Tel. ...

Еще в разделе: (Показать все результаты (>44) - foroff.phys.msu.ru/ )

... Лазарев А.А. , Werner F. в журнале Mathematical and Computer Modelling , издательство Pergamon Press Ltd. ... Lazarev A.A. , Werner F. в журнале Mathematical and Computer Modelling , издательство Pergamon Press Ltd. ... Vasin A.A. , Stepanov D. в журнале Mathematical and Computer Modelling , издательство Pergamon Press Ltd. ... Bikov A.A. , Popov V.Y. , Sveshnikov A.G. , Klibanov M. , Volkova I.O. , Tikhonravov A.V. в журнале Mathematical and Computer Modelling , издательство Pergamon Press Ltd. ...

Еще в разделе: (Показать все результаты (>2443) - istina.msu.ru/ )

• International Journal of Computer Vision - журнал | ИСТИНА - Интеллектуальная
• Mathematical and Computer Modelling of Dynamical Systems - журнал | ИСТИНА -
• Computer applications in the biosciences : CABIOS - журнал | ИСТИНА -

... MPI_Scan . ... starting address of send buffer (choice) . ... All MPI routines in Fortran (except for MPI_WTIME and MPI_WTICK ) have an additional argument ierr at the end of the argument list. ierr is an integer and has the same meaning as the return value of the routine in C. In Fortran, MPI routines are subroutines, and are invoked with the call statement. ... The reduction functions ( MPI_Op ) do not return an error value. ... MPI_ERR_BUFFER . Invalid buffer pointer. ... Центры . ...

Еще в разделе: (Показать все результаты (>589) - www.parallel.ru/ )

• MPE_Decomp1d | PARALLEL.RU - Информационно-аналитический центр по параллельным
• Querying File Parameters | PARALLEL.RU - Информационно-аналитический центр по
• computers | PARALLEL.RU - Информационно-аналитический центр по параллельным

... Protein Dynamics as Determinant of Function. ... Graph Matching with Dual-Step EM algorithm. IEEE Trans. ... A Graduated Assignment Algorithm for Graph Matching. ... Protein Structure Compaison by Alignment of Distance Matrices. ... Protein Structure: Insights from Graph Theory. ... Global and Local Protein Matching . A novel method for protein comparison based on EM-SVD (Expectation Maximization - Singular Value Decomposition) will be developed both for global and local similarities. ...

Еще в разделе: (Показать все результаты (>191) - www.genebee.msu.ru/ )

• GeneBee service

Алексеевский Андрей Владимирович . ... Миронов Андрей Александрович . ... Тем не менее, посещение страницы "Тьюторы ФББ" может быть полезным для выбора тьютора . ... Для студентов 1-го курса: Можно начать поиски тьютора уже сейчас! ... Активность в выборе темы и руководителя - за студентом. Студент выбирает руководителя и тему, просит руководителя взять его на данную тему. ... Студент сообщает о договоренности (фамилии студента и тьютора, название темы) Л.А.Зиновкиной . ...

Еще в разделе: (Показать все результаты (>905) - kodomo.cmm.msu.ru/ )

• Genebee DotHelix Motifs' Collection Map

... Accepting Arguments . ... PHP's implementation of variable arguments in fsockopen(). pval ** args [5]; int *sock=emalloc(sizeof(int)); int *sockp; int arg_count = ARG_COUNT (ht); int socketd = -1; unsigned char udp = 0; struct timeval timeout = { 60, 0 }; unsigned short portno; unsigned long conv; char *key = NULL; FLS_FETCH(); if ( arg_count 5 || arg_count 2 || zend_get_ parameters _array_ex( arg_count , ... Old way of retrieving arguments (deprecated) . ... Accessing Arguments ...

Еще в разделе: (Показать все результаты (>598) - oit.cmc.msu.ru/ )

• Assuring Write Safety for Other Parameters
• pdf_set_parameter
• pdf_get_pdi_parameter

... Department . ... Department of the Automation for Scientific Research (ASR) was founded in 1988 on the basis of research and teaching group of the Mathematical Physics Department (former Department of Computational Mathematics). ... Under his guidance the department performs wide spectrum of research in the field of computer simulation of complex systems and processes. ... 2008?2016 ASR Department , CMC Faculty , Lomonosov MSU . ...

Еще в разделе: (Показать все результаты (>18) - ani.cmc.msu.ru/ )

• The ASR Department at the CMC Faculty of Lomonosov MSU
• Department of the Automation for Scientific Research CMC MSU | Computational
• Courses | Department of the Automation for Scientific Research CMC MSU

... It has been shown [1], that in some cases, in chaos set A the sub-set B can exist, in which the chaos behavior can be stabilized by external parametrical perturbations. ... As the first step I've found the A set (the set of chaotic behavior) and as a second step, by using different parameters combination (that can be consider as parameter perturbations of the system) I've found the B set (the set, where some stable cycles exists). ... For the f(x)=ax(1-x) map this is [3,8 4,0] interval. ...

Еще в разделе: (Показать все результаты (>74) - chaos.phys.msu.ru/ )

... Spectral and kinetic parameters of phosphorescence of triplet chlorophyll a in the photosynthetic apparatus of plants. ... Spectral and kinetic parameters and quantum yield of IR phosphorescence accompanying radiative deactivation of the chlorophyll a (Chl a) triplet state were compared in pigment solutions, greening and mature plant leaves, isolated chloroplasts, and thalluses of macrophytic marine algae. ... This parameter is stable in leaves of different plant species. ...

Еще в разделе: (Показать все результаты (>52) - biochem.bio.msu.ru/ )

... NetCDF User's Guide for C . Unidata ( http://www.unidata.ucar.edu ) is a National Science Foundation-sponsored program empowering U.S. universities, through innovative applications of computers and networks, to make the best use of atmospheric and related data for enhancing education and research. ... The Network Common Data Form (netCDF) software described in this guide was originally intended to provide a common data access method for the various Unidata applications. ...

Еще в разделе: (Показать все результаты (>69) - angel.cs.msu.su/ )

• : Class Schema
• PhD Summer School on Scentific Computing

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>14) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... Chair of Computer Methods of Physics . Department of Physics, M.V. Lomonosov Moscow State University . Welcome to the website of Chair of Computer Methods in Physics! ... methods of analysis and interpretation of experiments (computing and measurements systems theory) . mathematical methods of image analysis and interpretation . methods of fuzzy and uncertain fuzzy . ... Department of Physics M.V. Lomonosov Moscow State University , Chair of Computer Methods of Physics , 2014 . ...

Еще в разделе: (Показать все результаты (>6) - cmp.phys.msu.ru/ )

• Добро пожаловать! | Кафедра математического моделирования и информатики
• User account | Chair of Computer Methods of Physics
• Contacts | Chair of Computer Methods of Physics

... КОМПЬЮТЕРНЫЙ ЦЕНТР . Филологического факультета . ... В 1991-1992 гг. факультет своими силами создает первый компьютерный класс. ... В 1995 г. факультет "накрывает" компьютерная сеть, и опять силами факультета в стенах сверлятся дырки, протягиваются кабели, монтируются концентраторы. ... класс в 860 ауд. - 11 рабочих мест. класс в 950 ауд. - 12 рабочих мест. класс в 951 ауд. - 12 рабочих мест. класс в 952 ауд. - 10 рабочих мест. ... e-mail: yegorov@philol.msu.ru . тел. 7 (495) 939-19-97 . ...

Еще в разделе: (Показать все результаты (>275) - www.philol.msu.ru/ )

• SCIENTIFIC AND TEACHING COMPUTER CENTRE
• Curriculum vitae.

... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . ... Необходима помощь: Read-Only DC и присоединение компов к домену. ... Re: Необходима помощь: Read-Only DC и присоединение компов к домену. [ re: Boom ] . ...

Еще в разделе: (Показать все результаты (>4469) - www.fds-net.ru/ )

• Программист-математик, computer vision, от 70к - Public forum of MSU united
• How to know Computer Browser service is runing on some computer? - Public forum
• Sell my computer - Public forum of MSU united student networks

... Structure of Data . ... Catalog . ... In SAI OCL Catalog, we introduce our work on investigation of the Milky Way system of open star clusters. The main goal of our study is a search for new clusters using huge surveys. 168 new clusters have been already discovered by us using J,H,Ks data from 2MASS point source catalog. ... For 141 new clusters, we found their physical parameters using J,H,Ks data from 2MASS catalog and, for a number of clusters, our UBVRI CCD observational magnitudes. ...

Еще в разделе: (Показать все результаты (>222) - ocl.sai.msu.ru/ )

• SAI OCL Catalog Structure

... Fridinger P.G., Reverdatto V.V., Polyansky O.P. Burial sediments metamorphism in rift structures of Earth crust (modeling approach), Geology and Geophysics, 1991, N9, p. 81-90 (in Russian) . ... Reverdatto V.V., Polyansky O.P. PT-evolution in alternative models of metamorphism , Reports of AS USSR, 1992, v.325, N5, p.1017-1020 (in Russian) . ... Reverdatto V.V., Sheplev V.S., Polyansky O.P. , Burial metamorphism and evolution of rift depressions, Petrology, 1995, v.3, N1, p.37-44 (in Russian) . ...

Еще в разделе: (Показать все результаты (>448) - geo.web.ru/ )

• Pletchov Pavel biography info

... Наука >> Вычислительная математика >> Теория и алгоритмы | ... 0 ] (обратно к тексту) Полная версия настоящего эссе: www.mi.ras.ru/~razborov/computerra.ps . 1 ] (обратно к тексту) S. Smale, "Mathematical problems for the next century", Mathematical Intelligencer , 1998, vol. 20, number 2, pages 7-15. [ 2 ] (обратно к тексту) А. Саломаа, "Криптография с открытым ключом", М.: "Мир", 1996. ... 6] А. Разборов, " P=NP , или Проблема перебора: взгляд из 90-х", www.mi.ras.ru/~razborov/phasis.ps . ...

Еще в разделе: (Показать все результаты (>483) - www.nature.web.ru/ )