... Second-year students classes . ... The course offers profound description of popular techniques of parallel programming such as OpenMP and MPI. ... Rapid growth of productivity of the modern computing systems is achieved by using parallel processors and multicore systems. ... As a result, by the and this course, students acquire knowledge about the popular parallel programming techniques, knowledge of modern high-performance computing systems and practical skills to work with them. ... Moscow: Binom...
... The main field of my investigations is stellar spectrophotometry. As a result of scientific activity of our group spectrophotometric catalog was created including energy distribution data on 900 stars in the range 3200-7600AA and 250 stars in the range 6000-10800AA (Voloshina et al., Spectrophotometry of Bright Stars, ed. I.N.Glushneva, 1982, Moscow, Nauka, in Russian). ...
... One of the most widely used tools of Fourier analysis is the Parseval theorem. It enables the experimentalist to view how the `energy' in the signal is distributed among frequencies. The Fast Fourier Transform (FFT) algorithms have made power spectra one of the obvious diagnostics tools during data acquisition, and energy maps are a versatile alternative. ... The result is an energy map (Fig. 9), showing the distribution of energy corresponding to the wavelet map (Fig. ...
The Chair of Mathematical Theory of Intelligent Systems and . ... Research . ... Information Monitoring . ... Search in Databases . ... It is possible this apparatus in an applied investigations on recognition of consecutive information. ... Investigation of possibility of using the additional (non-acoustic) sources of information for speech recognition. ... Investigations of possibilities of usage of methods of fussy logic, optimal control and others in solving of problems of speech recognition. ...
Modeling distribution of polymerized anions on the liquidus of the Na 2 O-SiO 2 system . In previous studies, we have presented a STRUCTON computer program designed for statistical simulations of molecular-size distribution of Si-anions in polymerized silicate melts ( Polyakov , Ariskin , 2008). ... in the Na 2 SiO 3 melt. ... Ariskin A.A., Polyakov V.B. Simulation of molecular mass distributions and evaluation of O 2- concentrations in polymerized silicate melts // Geochemistry International. ...
Next: State of development Up: Guided tour through MICO Previous: Guided tour through MICO . Modern programming languages employ the object paradigm to structure computation within a single operating system process. The next logical step is to distribute a computation over multiple processes on one single or even on different machines. ... The Common Object Request Broker Architecture (CORBA) is a specification of such a middleware platform by the Object Management Group (OMG) (see [ 5 ]). ...
The Fastdiag dynamic library (fastdiag.dll of Windows PC GAMESS/Firefly distributions, fastdiag.ex of Linux distributions) contains fast optimized modern algorithms of symmetric matrix diagonalization and inversion and is intended to improve the performance of initial guess generation, DIIS extrapolation, as well as some other computationally-intensive steps. ... However, DC-based code requires large amount of extra memory. ... It is usually as fast as kdiag=-1 but requires as much memory as kdiag=0. ...
... Practical courses . ... The architecture of data acquisition and control systems systems and laboratory works employs various types of plug-in boards, CAMAC modules, GPIB boards, original connecting cards and virtual generators, breadboard modules, and sound blasters, which are used as generators of analog signals of different shapes and as analog-to-digital converters. ... Pascal and C++ are employed to program the different blocks of data acquisition and control systems systems. ...
... Cleo batch system is purposed to control parallel tasks on computer clusters. It controls one or more task queues. tasks sceduling (all MPI implemetations are supported, most other parallel environments are supported too) . ... controllable user limits (max used cpus, task work time, etc.) . ... Any task in main will be queued to daughter queues if there aren't enough free own cpus (not shared with daughters). When daughter queues will get enough cpus for this task, it will be runned in main . ...
... Sections . ... Atlas "Birds of Moscow City" . ... Breeding bird atlas of European Russia . ... Annual report, issue 1 . ... The Fauna and Abundance of European Russia Birds", issue 1 . ... Br eeding bird atlas of European Russia . ... Project outputs : Accurate mapping of Russian birds in the 2nd European Breeding Bird Atlas, and a groundbreaking Atlas of Breeding Birds of European Russia . ... Atlas "Birds of Moscow City" Monitoring of common birds Breeding bird atlas of European Russia . ...
FEATURES OF THE HYDROGEN DISTRIBUTION AROUND LUNAR CRATERS PROCLUS AND KEPLER. ... In result of analysis of the data Lawrence and Feldman constructed the hydrogen distribution on the lunar surface [1]. ... However, the authors shown, that EN flux data features may be explained by other element abundance in the lunar soils, namely: Si, Ca, Gadolinium (Gd), Samarium (Sm) and Fe. ... Using of the Feldman's interpretation of the Lunar Prospector data [8], we constructed hydrogen distribution map (Fig.1). ...
[
Текст
]
Ссылки http://selena.sai.msu.ru/Shev/Publications/m44_76_sinitsin_shevchenko.pdf -- 164.0 Кб -- 16.03.2011 Похожие документы
. You can compare any two versions of a file that is under the control of SCCS with the sccsdiff command: /usr/sccs/sccsdiff -r version -r version s. filename . Using this command produces a line by line difference between the two versions of the file. Results are shown in the same format as that produced by the diff command. Examples .
... Mathematical Theory of Feedback Control . ... Annotation: this course is about mathematical equations of atmospheric diffusion which allow modeling of the problems of environment. ... The course reflects the experience and the point of view of a research group in the field of mathematical modeling of Western, Soviet and later Russian economics. ... Such approach captures the behavior of rather complex systems. ... Scientific Seminar: Mathematical Modeling of Complex Systems . ...
... О центре . ... Результаты тестирования за 5-8 апреля . ... номер решавшейся задачи, Время - время от начала тестирования (чч:мм:сс), когда был дан ответ на задачу, Правильность - правильность ответа в процентах, Раздел - раздел, к которому относилась задача (можно было видеть при тестировании). Результаты тестирования . ... Последнее обновление 08/04/2016 Физический факультет МГУ. ...
Origins and Evolution of Cinnamon and Camphor A phylogenetic and historical biogeographical analysis of the Cinnamomum group Introduction · Cinnamomum is a genus of evergreen aromatic trees and shr ubs belonging to the laurel family (Lauraceae). It is a primarily tropical and sub tropical Asian lineage with some species distributed in Neotropics, Australasia and Africa. ... The Bering and North Atlantic land bridges have been used to explain the migration of subtropical and tropical lineage. ...
[
Текст
]
Ссылки http://herba.msu.ru/shipunov/school/biol_330/presentations/cinnamon/cinnamon.pdf -- 874.7 Кб -- 06.04.2016 Похожие документы
... Number of required sensors is 10000 4 The part of ANTARES collaboration (http://antares.in2p3.fr/Collaboration/index.html) 5 The some direction of MSU group activity in the project · Bioluminescence cut · Quality cuts · SN search 6 Bioluminescence cut We have collected distributions of hit counts for each PMT during one K40 run (~45min) Usually these distributions consist of 2 parts Poissonian (due to K40 and plankton ... Conclusion Bioluminescence cut was done. ...
[
Текст
]
Ссылки http://antares.sinp.msu.ru/docs/Shirokov%20-%20The%20first%20results%20of%20MSU%20groups%20in%20ANTARES%20project.pdf -- 643.2 Кб -- 16.12.2013 Похожие документы
Laboratory of Systems for Automated Image Processing . ... Development of efficient methods for solving inverse problems of x-ray and wave tomography . ... Wave Tomography . ... The methods of solving inverse problems as coefficient inverse problems can provide information about the internal structure of the object even in the case of limited data tomography. ... One of the main challenges faced by ultrasonic tomography is the development of mathematical methods for solving inverse problems. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Laboratory of Mathematical Methods of Image Processing . ... Image analysis . ... Ringing effect . ... Ringing effect so known as Gibbs phenomenon in mathematical methods of image processing is the annoying effect in images and video appeared as rippling artifact near sharp edges. ... Ringing effect is usually introduced to image after different image processing algorithms. ... Scale-space method of image ringing estimation // In: Proceedings of International Conference on Image Processing (ICIP'09)...