... Among the methods of theoretical investigation of coordination compounds, molecular mechanics seems to be an optimal choice. However, conventional MM force fields typically do lack metal-related force field parameters. ... Let us calculate (MM) energy gradient for experimental structures using purely organic force field with no metal-dependent terms. ... In other words, thus calculated forces give an "imprint" for the derivation of metal-dependent forces. ...

Еще в разделе: (Показать все результаты (>377) - chem.msu.ru/ )

• Comparative Analysis of Intramolecular Parameters of Nitrocompounds:
• Optimization of Optical Scheme Parameters in Dual-Beam Thermal Lens...
• Photoacoustic detection of the parameters of laser vaporisation of amorphous

... Alexander Popov QFTHE P' 2010 , Golitsyno, September 14 2 Program package E vtGen The EvtGen package has been created for the simulation of the bhadrons decays at B-factories. ... Lowest order SM contributions to the decays. ... Alexander Popov QFTHE P' 2010 , Golitsyno, September 14 5 E vtGen model for rare radiative leptonic B-decays We prepare the new EvtGen model BSTOGLLMNT for rare radiative leptonic B-mesons decays. ... Alexander Popov QFTHE P' 2010 , Golitsyno, September 14 11 ...

Еще в разделе: (Показать все результаты (>140) - qfthep.sinp.msu.ru/ )

• http://qfthep.sinp.msu.ru/talks/qfthep2010_dubinin.pdf
• http://qfthep.sinp.msu.ru/talks2015/QFTHEP15_Vorotnikov_v9.pdf
• http://qfthep.sinp.msu.ru/talks2013/QFTP-2013_Bodnya__Derkach__Kovalenko__Puchkov__Feofilov1.pdf

... The determination of parameters of . the gravity anomalies sources . ... The interpretation of sources of the anomalies of the Earth's gravity field is carried out. ... 2) в общем неравновесном поле Земли учтено влияние масс рельефа планеты, компенсированного на некоторой глубине : . ... средний радиус поверхности рельефа, - средний радиус поверхности относительности, где - средняя глубина компенсации, - средняя плотность масс рельефа, - средняя плотность Земли. ... Параметры источников . ...

Еще в разделе: (Показать все результаты (>188) - lnfm1.sai.msu.ru/ )

• IMCCE-SAI: Natural Satellites Data Center (NSDC). Parameters
• IMCCE-SAI: Natural Satellites Service. Parameters and constants
• Scientific activity

... Software . Laboratory of Mathematical Methods of Image Processing . ... Available options: -sigma - (mandatory) set blur parameter for the input image , range: 1.0 to 20.0 - power - set warping power , range: 0.0 to 5.0, default value is 1.0 -1d - apply one-dimensional algorithm (faster but lower quality) basicedges - detect basic edges - edges good for artifact analysis -scale - set scale parameter, range: 1.0 to 20.0, default value is 4.0 gaussblur - blur input ... warp.png . ...

Еще в разделе: (Показать все результаты (>113) - imaging.cmc.msu.ru/ )

• View publication | Laboratory of Mathematical Methods of Image Processing

... Spectral and kinetic parameters of phosphorescence of triplet chlorophyll a in the photosynthetic apparatus of plants. ... Spectral and kinetic parameters and quantum yield of IR phosphorescence accompanying radiative deactivation of the chlorophyll a (Chl a) triplet state were compared in pigment solutions, greening and mature plant leaves, isolated chloroplasts, and thalluses of macrophytic marine algae. ... This parameter is stable in leaves of different plant species. ...

Еще в разделе: (Показать все результаты (>32) - biochem.bio.msu.ru/ )

... Next Routine] [List of Routines] NAME: ADD_HEADER PURPOSE: addition information from FITS-headers MPFS-frames DESCRIPTION: The function computes the total exposure, mean value zenit distance and modified FITS header CALLING SEQUENCE: Result =ADD_HEADER( headers ) CATEGORY: reduction MPFS-data INPUTS: Headers = String array FITS-headers from the MPFS data OUTPUTS: Header = String array containing the header from the FITS file. ... OPTIONAL INPUT KEYWORD PARAMETERS: BEFORE = Keyword string name. ...

Еще в разделе: (Показать все результаты (>44) - sn.sai.msu.ru/ )

Parameters: . Atom list: strict . Model number (for NMR): not applicable to biounits . All chains selected . Distance threshold: 5.4 Input file: 1a1l.pdb1.pdb . Output files: . 1a1l.pdb1.rsc RasMol script . 1a1l.pdb1.txt text table Goto Jmol page . You must run Java enabled browser, compatible with Jmol. More information is available at http://jmol.sourceforge.net/docs/JmolAppletGuide.html#SupportedBrowsers . Ask a question about this service: sas@belozersky.msu.ru

Еще в разделе: (Показать все результаты (>200) - monkey.belozersky.msu.ru/ )

• SDPpred
• SDP home page

... Conserved factor . Compensated factor . Cluster factor . ... Part of sequence . ... Alignment Sequence . Include picture . No Picture Only Structure Structure and BP numbers Structure and Stem Energy Full Picture . ... Alignment OR sequence (without name). ... ANMF CGCGGGGTAGAGCAGCCTGGTAGCTCGTCGGGCTCATA AQTRNF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAA BGTRF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAT ANMF ATCCTCTCCCCGCC---- AQTRNF ATCCGCCTCCCGGCACCA BGTRF ATCCGCCTCCCGGCACCA . ...

Еще в разделе: (Показать все результаты (>122) - www.genebee.msu.ru/ )

• GeneBee BLAST 2.2.8 Services
• GeneBee BLAST 2.2.22+ Services
• GeneBee BLAST 2.2.8 Services Help

О лаборатории . ... Лаборатория теоретической биофизики . ... Here the guide to use RESP technique based on calculations from Firefly or GAMESS-US is presented. ... Note, that RESP algorythm will fit potential in the set of points which are selected according to $PDC group in the input-file. ... Нет комментариев " Using RESP with GAMESS-US and Firefly (PC-GAMESS) " . ... Using Firefly/GAMESS-US efficiently . ... Scannin? in Using Firefly/GAMESS-US efficiently? 2012 ERG Research Group . ...

Еще в разделе: (Показать все результаты (>23) - erg.biophys.msu.ru/ )

• Visual approach to construction of &QMMM section of CP2K input file ERG
• toolset ERG Research Group: Лаборатория теоретической биофизики
• python ERG Research Group: Лаборатория теоретической биофизики

... Krupa 1, 2 and M. Jandel 1 Institute of Physics, Slovak Academy of Sciences, Bratislava, Slovakia 2 Flerov Laboratory of Nuclear Reactions, JINR, Dubna, Russia 3 Laboratory of High Energies, JINR, Dubna, Russia * E-mail: matousek@savba.sk ACAT - 2002 c , M. MorhА 1, 2 , J. Kliman 1, 2 , 1, 2 June 24 ґ 28, 2002 DATA STORING Data types Ї list of events Ї histograms (spectra) 1, 2, 3, 4-dimensional Event formats Supported event formats for off-line analysis Ї Acq format E E . ...

Еще в разделе: (Показать все результаты (>60) - acat02.sinp.msu.ru/ )

• http://acat02.sinp.msu.ru/presentations/morhac/ACAT2002_Morhac_ID142.pdf
• http://acat02.sinp.msu.ru/presentations/kryukov/acat02-020625.pdf
• http://acat02.sinp.msu.ru/presentations/vaiciulis/acat2002.ps

Geometrical core (core) is a maximal set of alignment positions such that C atoms in these positions are disposed similarly in ALL input protein chains. ... Minimal core size (#aa's) . ... Alternative core new atoms (%) . ... Geometrical core is a maximal set of alignment positions such that C atoms in these positions are disposed similarly in ALL input protein chain. ... Each input sequences is aligned to the corresponding sequence obtained from the ATOM section of the protein chain in the PDB file. ...

Еще в разделе: (Показать все результаты (>14) - mouse.belozersky.msu.ru/ )

• NPG-explorer

University Satellites and . Space Science Education . ... The purpose of the developed scientific - educational program complex is creation on the Earth on the base of telemetry data of virtual model of microgravitational environment in which experiments are carried out, and virtual motion model of of the space vehicle. ... The developed program complex concerns to the class of the distributed program systems. ... Skobeltsyn Institute of Nuclear Physics, Moscow State University, 2005-2006 . ...

Еще в разделе: (Показать все результаты (>6697) - cosmos.msu.ru/ )

• Space Scientific and Education project of Lomonosov Moscow State University

Estimation of translational importance of mammalian mRNA nucleotide sequence characteristics based on ribosomal profiling data O.A. Volkova1,*, Y.V. Kondrakhin2,3, R.N. Sharipov 1 2,3,4 Institute of Cytology and Genetics, SB RAS, Novosibirsk, Russia 2 Design ... Novosibirsk, Russia 4 Novosibirsk State University, Novosibirsk, Russia *ov@bionet.nsc.ru Keywords: ribosome profiling, RiboSeq, 5'UTR , mRNA , ... Until recent time there were no experimental data on the translation efficiency. ...

Еще в разделе: (Показать все результаты (>151) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/16.pdf
• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/26.pdf
• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/116.pdf

... DEPRON device (Dosimeter of Electrons, PROtons and Neutrons) is intended for the measurements of  the absorbed doses and linear energy transfer spectra from high-energy electrons, protons and nuclei of space radiation, and for detecting of thermal and slow neutrons flux. ... Charged particles dosimeter based on semiconductor detector . ... For each detected particle an amplitude of impulse proportional to the energy lost by the particle in the detector?s track sensitive volume is registered. ...

Еще в разделе: (Показать все результаты (>20) - lomonosov.sinp.msu.ru/ )

• ELFIN-L | Университетский спутник "Ломоносов"
• TUS | Университетский спутник "Ломоносов"
• Information unit (BI) | Университетский спутник "Ломоносов"

MPI. ... C: #include <mpi.h> 14 MPI MPI- C (case sensitive): error = MPI_Xxxxx(parameter,.. ... Send : , , ґ Receive: , , 27 MPI () MPI - , (blocking) (non-blocking) ґ Blocking: ґ Non-blocking: , 28 MPI (modes) (Mode) Synchronous send Buffered send Standard send Ready send Receive (Completion Condition) ( ), ( ) ( ), 29 MPI ?-? () (MODE) Standard send Synchronous send Buffered send Ready send Receive MPI MPI _ Send MPI _ Ssend MPI _ Bsend MPI _ Rsend ...

Еще в разделе: (Показать все результаты (>8) - angel.cmc.msu.ru/ )

... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . ... Как получить дескриптор окна в VBA? . ... Re: Как получить дескриптор окна в VBA? [ re: Domain ] . ... Re: Как получить дескриптор окна в VBA? [ re: Kolya ] . ...

Еще в разделе: (Показать все результаты (>3694) - www.fds-net.ru/ )

• Как запустить экзэшник визуалка 2005 под винду - Public forum of MSU united
• прога удаленного форматирования по дате - Public forum of MSU united student
• Писать под форум [чит] - Public forum of MSU united student networks

THE PARAMETERS INVOLVED IN HAPKE'S MODEL FOR ESTIMATION OF THE COMPOSITION OF THE EJECTA LUNAR TERRAINS. ... In the previous papers we were estimated the surface roughness of the ejecta lunar terrains by means comparison of the local phase function and the average integrated lunar indicatrix. ... The Hapke's theoretical model of the lunar surface reflection. ... For THE PARAMETERS INVOLVED IN HAPKE'S MODEL: S.G. Pugacheva, V.V. Shevchenko a low-albedo lunar surface parameter Bo = 1. ...

Еще в разделе: (Показать все результаты (>85) - selena.sai.msu.ru/ )

• http://selena.sai.msu.ru/Shev/Publications/ms38/ms084.pdf
• http://selena.sai.msu.ru/Pug/Publications/ms38/ms080.pdf
• http://selena.sai.msu.ru/Pug/Publications/m44_70_pugacheva.pdf

... Data . ... Planetary perturbations during geomagnetic storms are measured by the Dst index, which is the deviation of variation of the magnetic field from the undisturbed level, averaged over the values measured at the control chain of magnetic stations located in the low latitudes. ... To predict the hourly values of the Dst index, artificial neural networks (ANN) of perceptron type are used. ... Loading of the data on the values of the Dst index and forecast update are performed twice per hour. ...

Еще в разделе: (Показать все результаты (>102) - swx.sinp.msu.ru/ )

• SWX - Космическая погода
• SWX - Главная
• SWX - Магнитосфера

... VaST is a software tool for finding variable objects on a series of astronomical images. ... VaST performs object detection and aperture photometry using SExtractor on each image, cross-matches lists of detected stars, performs magnitude calibration with respect to the first (reference) image and constructs a lightcurve for each object. ... VaST FITS image viewer ./pgfv . ... Part I" PZP, vol. ... K. V. Sokolovsky, S. A. Korotkiy; "New Variable Stars Discovered by the NMW Survey" PZP, vol. ...

60. Electron Beam Laboratory