... David Kirk/NVIDIA and Wen-mei W. Hwu , 2007-2012 ECE408/CS483, University of Illinois , Urbana-Champaign 14 CUDA Device Memory Management API functions · cudaMalloc() ­ Allocates object in the device global memory ­ Two parameters · Address of a pointer to the allocated object · Size of of allocated object in terms of bytes ( Device ) Grid Block (0, 0) Block (0, 1) Registers Registers Registers Registers · cudaFree() ­ Frees object from ...

Еще в разделе: (Показать все результаты (>4) - ccoe.msu.ru/ )

NGS Data Analysis with Unipro UGENE Olga Golosova, Yuriy Vaskin, German Grekhov, Yuliya Algaer UNIPRO, Lavrentieva ave. ... That is where Unipro UGENE NGS framework comes in play. ... Moreover, the UGENE toolkit allows one to automate common tasks by creating workflows with the integrated tools using the UGENE Workflow Designer. Analysis of NGS data with UGENE may start, for example, from quality control of raw NGS data, received from a sequencing facility, with the integrated FastQC [3] tool. ...

Еще в разделе: (Показать все результаты (>114) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/68.pdf
• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/120.pdf
• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/198.pdf

... Полная версия этой страницы: Каррент мьюзик . Студенческий форум Физфака МГУ > Общий > ТРЕП > Карренты . ... True andЪ EvilЪ . ... Posted by 195.91.219.66. of WebWarper: see /han Example of using WebWarper: http://www.webwarper.net/ww/~av/forum.dubi...hp?showforum=42 ] . ... Posted by 195.91.219.66. of WebWarper: see /han Example of using WebWarper: http://www.webwarper.net/ww/~av/forum.dubi...dex.php?act=idx ] . ... 8.12.2005, 0:27 . ...

Еще в разделе: (Показать все результаты (>505) - wasp.phys.msu.ru/ )

• Студенческий форум Физфака МГУ > Ассоциации
• Студенческий форум Физфака МГУ > Current Doing
• Студенческий форум Физфака МГУ > Игра "кошка или собака"

... создается некое подобие 3-х мерного пространства Слова показа и и отображены таким же способом. -- param name =example_object_0 value = pltext step =20 font =Verdana:28,3 value =%АППЛЕТ% link = exline :0 color =#009999 param name =example_object_1 value = pltext step =20 shifts=2,2 font =Verdana:28,3 value =%АППЛЕТ% link = ...

Еще в разделе: (Показать все результаты (>15) - adept.srcc.msu.ru/ )

• http://adept.srcc.msu.ru/adept/java/applet_book/layer/layer4text1.htm
• http://adept.srcc.msu.ru/adept/java/applet_book/cursor/cursor1text1.htm
• http://adept.srcc.msu.ru/adept/java/applet_book/layer/layer1text1.htm

... 19-21 ноября 2002 г. при участии Правительства Москвы, Министерства образования РФ и Комиссии РАН по работе с молодежью состоялась Московская конференция молодых ученых 'Научно-технические проблемы развития Московского мегаполиса'. ... На организованной в рамках конференции выставке были представлены стендовые доклады и экспонаты. ... Конференция молодых ученых продемонстрировала высокий научный уровень и актуальность проводимых исследований. pr.cnews.ru . ...

Еще в разделе: (Показать все результаты (>60) - www.mmonline.ru/ )

• MMOnline | Работа | Компания Interface Ltd. содействовала проведению Московской
• MMOnline | Новости | Компания Interface Ltd. содействовала проведению
• Математический семинар Глобус. 11 марта 2004 г.

... CompHEP Models. ... CompHEP is based on an idea of the physical model. ComHEP Models are very simular to physical models in high energy physics, like Standards Model or MSSM. ... Two of them are versions of the Standard Model (SU(3)xSU(2)xU(1)) in the unitary and t'Hooft - Feynman gauges. ... Standard Model in Feynman gauge . ... This output can be written in LaTeX format and in the form of CompHEP model files, which allows one to start calculations of processes in the new physical model. ...

Еще в разделе: (Показать все результаты (>24) - comphep.sinp.msu.ru/ )

• news [CompHEP]
• download:rn-031116 [CompHEP]
• download:main [CompHEP]

... While assessing the effects of vegetation burning on soil properties, Mills Fey (2004) proposed the term pedoderm to describe those first few centimetres of soil in which certain properties are often expressed much more strongly than in the remainder of the soil surface horizon. ... The pedoderm hosts or serves as substrate for the formation of both biological and physical crusts of the kind described, respectively, by Belnap and Lange (2003) and Singer and Shainberg (2004). ... 2003; Cadenasso et...

Еще в разделе: (Показать все результаты (>87) - www.fadr.msu.ru/ )

• http://www.paleopedology.msu.ru/discussions/messages/51.html

... A hybrid heuristic parallel method of global optimization" . ... A hybrid heuristic parallel method for solving of complicated global optimization problems is proposed. ... The method is compared with 21 modern methods of global optimization and with a genetic algorithm using 28 test objective functions of 50 variables. Keywords: global optimization, heuristic methods, neural networks, parallel computing, C++, MPI. ...

Еще в разделе: (Показать все результаты (>135) - num-meth.srcc.msu.ru/ )

• "Mathematical modeling of the 3D evolution problem for the interface between
• "Design of the application programming interface for a Pilot RESTful grid
• "TIM-parallelization in a shared memory model using OpenMP interface"

... Ярмарка вакансий и стажировок для студентов и выпускников вузов . ... Вакансии . ... Mobile Handset / Mobile Phone . ... Multimedia framework: multimedia framework development in Android platform by using mobile chipset . User interface (UI) framework in mobile platforms: UI framework development in Android platform by using mobile chipset . ... Multimedia framework in mobile platform: . ... Multimedia framework architecture design in mobile platform . ... UI framework in mobile platform: . ...

Еще в разделе: (Показать все результаты (>38) - www.physcareer.ru/ )

... Mathematical Treatment of Exhaust Systems with Acoustic Properties Using Mathlie I. Algorithms . ... The first part of the two talks is concerned with   algorithms applied to examples origin from an   exhaust system. ... The model equations are determined   by conservation of mass, momentum and energy. In addition there exists an equation of state   for the ideal gas system. ... Applying computer algebra to   these model equations, we demonstrate that   solutions can be derived. ...

Еще в разделе: (Показать все результаты (>87) - acs366.phys.msu.su/ )

XAFS spectroscopy is widely used in physics, materials science, chemistry (especially in catalysis and coordination chemistry), biology, geochemistry and environmental science. ... This is an interface to the Glimpse -based search engine which enables you to find published papers in different fields of x-ray absorption spectroscopy -- XAFS, EXAFS, XANES, NEXAFS, SEXAFS, XEOL, and EXAFS-like phenomena in photoemission, electron-energy-loss spectra and so on. ... Database Search Form . ...

Еще в разделе: (Показать все результаты (>3) - scon155.phys.msu.ru/ )

• XAFS Publication Database search form

... Продаю iRig - guitar interface adapter for iPad/iPhone/iPod Touch . ... Re: Продаю iRig - guitar interface adapter for iPad/iPhone/iPod Touch [ re: Black_HobbiT ] . ... Re: Продаю iRig - guitar interface adapter for iPad/iPhone/iPod Touch [ re: mukav ] . ...

Еще в разделе: (Показать все результаты (>1147) - www.fds-net.ru/ )

• Программист для part-time работы в стартапе (brain-computer interface) - Public
• debian sucks or i suck - Public forum of MSU united student networks
• как настроить smb.conf и запустить демоны smbd и nmbd? - Public forum of MSU

LangueDOC . ... Languages . ... Archi . ... The phonetic system of Archi is very rich, and the writing systems that are familiar to Archi speakers (Russian cyrillic and Avar cyrillic) are not sufficient for recording all sounds of the language. ... Kibrik et al. 1977] ? the notation used in this dictionary is given in the comparative table below under the label "1977"; [Kibrik, Kodzasov 1990]), but they were too difficult for the Archi speakers to learn and therefore remained inaccessible to them. ...

Еще в разделе: (Показать все результаты (>184) - www.philol.msu.ru/ )

• Entry page

... Data . ... Models . Solar energetic particles . Paraboloid model . ... Neutron flux variations (RU) . ... This program package is intended to prognose the environment on the board of near-earth elliptic orbiting satellites in the open space as well as behind the Al shielding. ... Next is the required spectrum type (integral or differential). ... sp_x.txt - solar proton spectrum behind shielding, fluence . sn_x.txt - solar neutron spectrum behind shielding, fluence . ... Solar . ...

Еще в разделе: (Показать все результаты (>12) - smdc.sinp.msu.ru/ )

• APEV service - Space monitoring data center
• ShielDose2 model - Space monitoring data center

. H.Popova, M.Artyushkova, D.Sokoloff, The WKB approximation for the interface dynamo, GAFD, 2010 . Ключевые слова:

Еще в разделе: (Показать все результаты (>31) - srcc.msu.ru/ )

• M.E.Artyushkova, H.P.Popova, D.D.Sokoloff, Modeling of the solar interface
• Университетское образование в мире.Франция

... Software . Laboratory of Mathematical Methods of Image Processing . ... Available options: -sigma - (mandatory) set blur parameter for the input image , range: 1.0 to 20.0 - power - set warping power , range: 0.0 to 5.0, default value is 1.0 -1d - apply one-dimensional algorithm (faster but lower quality) basicedges - detect basic edges - edges good for artifact analysis -scale - set scale parameter, range: 1.0 to 20.0, default value is 4.0 gaussblur - blur input ... warp.png . ...

Еще в разделе: (Показать все результаты (>636) - imaging.cmc.msu.ru/ )

Astronomy Picture of the Day . NGC 5307: A Symmetric Planetary Nebula . ... 31.12.1997 . ... Credit: H. Bond ( STScI ) R. Ciardullo ( Penn State ), WFPC2 , HST , NASA Explanation: Some stellar nebulae are strangely symmetric. ... NGC 5307 is an example of a planetary nebula with a spiral shape. ... December 1997 . ... U. Based on Astronomy Picture Of the Day . Publications with keywords: planetary nebula . Publications with words: planetary nebula . ... NGC 3132: The Eight Burst Nebula . ...

Еще в разделе: (Показать все результаты (>2074) - www.astronet.ru/ )

• High Noon Analemma Over Azerbaijan
• XWare > APOD
• Journal "Peremennye Zvezdy"

... Alignment Sequence . Include picture . No Picture Only Structure Structure and BP numbers Structure and Stem Energy Full Picture . Sequence name . Alignment OR sequence (without name). The usage of Alignment is strongly recommended. Alignment example: . ... ANMF CGCGGGGTAGAGCAGCCTGGTAGCTCGTCGGGCTCATA AQTRNF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAA BGTRF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAT ANMF ATCCTCTCCCCGCC---- AQTRNF ATCCGCCTCCCGGCACCA BGTRF ATCCGCCTCCCGGCACCA . ...

Еще в разделе: (Показать все результаты (>142) - www.genebee.msu.ru/ )

• Screening pattern or alignmemt against PROTEIN databank
• AliComp - GeneBee Alignments Comparison - Advanced
• GeneBee service

... The exercises cover the following areas: Session A covers three ways you can use ROOT: the command line, the script processor, and the graphical user interface (GUI). ... Session A: | ... Display |cern.ch/root/Atlfast.html| ... Use the ROOT command line . ... In a new session open the new ROOT file (altfast.root) and find the TFile method to print the compression factor: root[] TFile f("atlfast.root") root[] f.<TAB> 3: What is the size and compression factor of the generated file, atlfast.root? ...

Еще в разделе: (Показать все результаты (>59) - acat02.sinp.msu.ru/ )

• http://acat02.sinp.msu.ru/presentations/ivanchenko/iv.pdf
• http://acat02.sinp.msu.ru/presentations/brun/Solutions_2.doc
• http://acat02.sinp.msu.ru/presentations/GGtut/Dev-02-Basics1.pdf

. Moscow State University . INTERNATIONAL CONFERENCE . H YDRODYNAMIC I NSTABILITY AND T URBULENCE . February 24 ? March 02 , 2008 . Moscow, Russia . Call For Papers Информационное письмо . Author instructions . Abstract example Paper example . Location (More information) . Conference Program Posters . E-mail : gertsens@imec.msu.ru . Institute of Mechanics, Lomonosov Moscow State University . Aerodynamical Installations . Moscow Sights & Attractions

Еще в разделе: (Показать все результаты (>12) - hit-conf.imec.msu.ru/ )