... About 70 scientific papers. The theory of square parachute is created, describing distribution of parameters of shape, tension and resistance to airflow of canopy in steady-state condition for various sets of suspension line lengths and air-permeability. ... The practical recommendations for optimal parachute application are submitted. ... It is discovered experimentally that a character of pressure distribution for a square canopy depends on a particular choice of suspension line lengths. ...

Еще в разделе: (Показать все результаты (>7) - margaret.imec.msu.ru/ )

NAME httpd - Apache hypertext transfer protocol server SYNOPSIS httpd [ - X ] [ - R libexecdir ] [ - d serverroot ] [ - f config ] [ - C directive ] [ - c directive ] [ - D parameter ] httpd [ - h ] [ - l ] [ - L ] [ - v ] [ - V ] [ - S ] [ - t ] [ - T ] DESCRIPTION httpd is the Apache HyperText Transfer Protocol (HTTP) server program. ... This manual page only lists the command line arguments. ... Paths in this manual may not reflect those compiled into httpd. ... The default is /usr/local/apache . ...

Еще в разделе: (Показать все результаты (>85) - neptun.sai.msu.ru/ )

• Server-Wide Configuration
• Manual Page: htdigest - Apache HTTP Server
• Apache module mod_so

. The Camtasia Studio video content presented here requires a more recent version of the Adobe Flash Player. If you are you using a browser with JavaScript disabled please enable it now. Otherwise, please update your version of the free Flash Player by downloading here .

Еще в разделе: (Показать все результаты (>272) - www.philol.msu.ru/ )

• LangueDOC :: Movie

... GLOBAL SOIL CHANGE: TIME-SCALES AND RATES OF PEDOGENIC PROCESSES (GSC-MEXICO-2005) . With pre-and post-conference field trips Montecillo, Mexico, March 29-April 06, 2005 . ... Chairmen: Prof., Dr. Benjamin Figueroa Sandoval, Director Central, Colegio de Postgraduados, Montecillo, Texcoco, Mexico, e-mail: Benjamin@colpos.colpos.mx . ... I intend to participate in the International Conference "Global Soil Change: Time-scales and Rates of Pedogenic Processes" in Mexico, March 29 - April 06, 2005 . ...

Еще в разделе: (Показать все результаты (>104) - www.fadr.msu.ru/ )

Lomonosov project . ... Mikhail Lomonosov . Scientific goals . ... Magnetospheric particles and radiation conditions . ... Scientific equipment . ... ELFIN-L . ... It consist of a Flux Gate Magnetometer (FGM), an Energetic Particle Detector for Electrons (EPDE), and an Energetic Proton Detector for Ions (EPDI). ... Energetic particles create a hazardous environment for satellites and humans in space and cause a number of satellite failures. ... Magnetospheric particles and radiation environment . ...

Еще в разделе: (Показать все результаты (>45) - lomonosov.sinp.msu.ru/ )

• DEPRON | Университетский спутник "Ломоносов"
• Information unit (BI) | Университетский спутник "Ломоносов"

Diploma thesis abstract by Arslanov D.D. Generation and diagnostic of cluster beams of xenon by adiabatic explosion gas through conical nozzle. Developed and created experimental setup for formation a cluster beam by adiabatic expansion of gas through impact nozzle, consisting of a stagnation chamber, impact conical nozzle with electronic control system piezoceramics valve, interactions chamber, evacuation system. ... Have parameter estimates of cluster beam for an ideal impact conical nozzle. ...

Еще в разделе: (Показать все результаты (>174) - ofvp.phys.msu.ru/ )

• http://ofvp.phys.msu.ru/en/science_education/diploma/annot/2010/Ivanov_Uryupina_en.pdf
• http://ofvp.phys.msu.ru/en/science_education/diploma/annot/2008/Knyazkov_Savelev_en.pdf
• Публикация

Evolution as a hard combinatorial problem D. Grigoriev, CNRS, Universitґ de Lille, dmitry.grigoryev@math.univ-lille1.fr e J.Reinitz, Dept.of Statistics, Chicago University, reinitz@galton.uchicago.edu S. Vakulenko, Institute for Mechanical Engineering Problems, Saint Petersburg, vakulenfr@mail.ru A. Weber, Computer Science Department, University of Bonn, weber@cs.uni-bonn.de We consider complexity emergence problem and formation of complex organs. ... The number n >> 1 is the gene number. ...

Еще в разделе: (Показать все результаты (>262) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/147.pdf
• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/6.pdf
• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/148.pdf

... Outline One-dimensional picture of T evolution Two-dimensional picture ( v1 (T), v2(T) ) Bifurcation sets in the catastrophe theory Results for the MSSM parameter space One-dimensional picture. ... 33 (1931) 72 The four bifurcation sets for U(v1,v2 | 1,2,3,4,5) Set (1) is an elementary Sylvester's criteria Set (4) also elementary, sets (2) and (3) give Where is the light stop? ... Four bifurcation sets are found in the general THDM then projected onto the MSSM parameter space. ...

Еще в разделе: (Показать все результаты (>191) - qfthep.sinp.msu.ru/ )

• http://qfthep.sinp.msu.ru/talks/QFTHEP2010Dolgopolov.pdf
• http://qfthep.sinp.msu.ru/talks2011/anomalous_wtb_qfthep11.pdf
• http://qfthep.sinp.msu.ru/talks/kinks.pdf

... Given package is a set of special commands and their handler - JOB program. The command aimed for description of often performed operations with files of PC-GAMESS program (dat, out, pun). ... Commands allow running calculation, performing other programs, data change between files and modification of files. ... Command inserts specified group in file.inp. ... del_g h2o.dat |Command deletes all repetition of| |$basis |specified group in file.inp. ... Command changes contents of group on specified | ...

Еще в разделе: (Показать все результаты (>81) - classic.chem.msu.su/ )

• How to run Firefly under Linux?
• Firefly Documentation
• Marek Checinski

Bolshakov D.K., Modin I.N., Pervago E.V., Shevnin V.A. Modeling and interpretation of azimuthal resistivity sounding over two-layered model with arbitrary - oriented anisotropy in each layer. ... Therefore an algorithm and program of modeling and interpretation of azimuthal resistivity sounding (ARS) data I over two-layered model with arbitrary - oriented anisotropy in each layer has been developed. ... We calculated a series of two-layered models with an anisotropy in first or in the second layer. ...

Еще в разделе: (Показать все результаты (>64) - geophys.geol.msu.ru/ )

• http://geophys.geol.msu.ru/STUDY/manual/ie2.doc
• http://geophys.geol.msu.ru/gravity.htm
• http://geophys.geol.msu.ru/STUDY/manual/ip1dmine.doc

sparallel.ru . Older posts . Newer posts . Posted by admin . ... Continue reading . Posted in Разное . Мар 17 . ... В интернет-магазине Cityboots представлена последняя коллекция обуви от Fabi по доступной цене. ... Posted in Ботинки . ... Широко известный канадский бренд бюджетной мужской и женской обуви. ... Posted in Кросовки . ... Posted in Сандалии . ... совокупный доход, получаемый этими ?обуви? или ? ... Экологически чистая обувь, обувь которая ?дышит? ? ... обувь изо льна. ...

Еще в разделе: (Показать все результаты (>4) - sparallel.ru/ )

• sparallel.ru - Part 106

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>10) - mouse.genebee.msu.ru/ )

php /* * Backup script on server. ... Connects to the mySQL * database and creates a backup file of the whole database. ... Yes/No? ... It will void your warranty :-D! $ date = date ( mdy-hia ); $filename = $savepath/$dbname-$ date .sql ; if($use_gzip== yes ){ $ filename2 = $ file ; } else { $ filename2 = $savepath/$dbname-$ date .sql ; } if($send_email == yes ){ $fileatt_type = filetype($ filename2 ); $ fileatt_name = .$dbname. - .$ ... BR>"; $message .= "--{$mime_boundary}\n" ." ...

Еще в разделе: (Показать все результаты (>47) - observ.pereplet.ru/ )

The use of the external module Electrum.dll Electrum.dll file is an external module for the Gibbs program, and is designed to calculate the activity coefficients of the components of gold- silver alloy (solid solution). ... Preparation of the System file To be able to use the module Electrum.dll, you need to include a binary solid solution of metallic gold and silver into the System file, as you create it. ... Similarly, it is set for the Control file when editing the list of Gibbs program options. ...

Еще в разделе: (Показать все результаты (>112) - www.geol.msu.ru/ )

• http://www.geol.msu.ru/deps/geochems/soft/en/Ab_An.doc
• http://www.geol.msu.ru/deps/geophys/gravity.htm
• http://www.geol.msu.ru/deps/geochems/soft/en/ZnS_FeS.doc

... For the past years I have been working on the problem of synthesis of light curves of close binary systems, consisting of a normal star and a compact object (point object with fixed X-ray luminosity). ... Possible existence of a bright spot on the disk's lateral surface is taken into account. ... The last of then will be published in Gordon and Breach Publishers ( Cherepashchuk A.M., Katysheva N.A., Khruzina T.S., Shugarov S.Yu. ... Cherepashchuk A.M., Katysheva N.A., Khruzina T.S., Shugarov S.Yu. ...

Еще в разделе: (Показать все результаты (>27) - uranus.sai.msu.ru/ )

• Irina Glushneva

... Laboratory of laser spectroscopy of solutions of supramolecular compounds and nanostructures is very young. We have grown up in the laboratory of laser spectroscopy of water media. ... Use of such powerful modern tools of solution of inverse problems and problems of optimization provides successful solution of a wide range of applied problems of diagnostics and analysis of water media. ... 2016 Laboratory of laser spectroscopy of solutions of supramolecular compounds and nanostructures . ...

Еще в разделе: (Показать все результаты (>25) - rswater.phys.msu.ru/ )