... Next: Threshold filtering Up: Data Analysis (Operations Menu) Previous: Surface Corrugation Contents Index . If you have selected a surface region on the surface, then the value of its square can be found using the Command Surface Square . ... Next: Threshold filtering Up: Data Analysis (Operations Menu) Previous: Surface Corrugation Contents Index Filonov 2005-02-04 ...

Еще в разделе: (Показать все результаты (>97) - www.spm.genebee.msu.ru/ )

• Select surface region
• COM-port initialization file format
• Changing the size of scanning window

Chemical journals list . Chemical journals list journals from ChemNet list . LINK The Visionary Information Service (Online Libraries and List of Journals) . ... WWW Virtual Library (Chemistry Section) Web-libraries . ChemWeb Library . ... The World-Wide Web Virtual Library Chemistry . ... Chemical Engineering Scientific information search . ChemWeb Library Search full text search in ChemWeb article database. ... Catalysis Patents patent search in ChemWeb database. ... search | ...

Еще в разделе: (Показать все результаты (>25) - www.kge.msu.ru/ )

The Department of Talented Youth Affairs and Professional Orientation . ... Olympiads . ... All-army olimpiad . ... Olympiad for School Pupils . ... Olympiad for school pupils was held in 2005 under the motto ?Via scientiarum?, which means ?The way to the knowledge? in Latin. ... The 46 th Mendeleev International Olympiad in Chemistry for School Pupils was held in Kazakhstan in the 2011-2012 school year. ... 2016 - The Department of Talented Youth Affairs and Professional Orientation ...

Еще в разделе: (Показать все результаты (>60) - talant.msu.ru/ )

• Junior Space School in MSU SINP | The Department of Talented Youth Affairs and
• admin | The Department of Talented Youth Affairs and Professional Orientation |
• The All-Russian National History test | The Department of Talented Youth

INSTALLATION The ebuild installs most parts of openwebstats automatically, but you will have to create a database for the apache log records. You can do this using the following commands as the mysql root user: > mysql -u root -p -e "CREATE DATABASE ows; GRANT CREATE, SELECT, INSERT, UPDATE, DELETE ON ows.* ... If you use a special logfile format for your web server you should also modify the log format in the config.php file. ...

Еще в разделе: (Показать все результаты (>10213) - mirror.msu.net/ )

• Index of /pub/gentoo-portage/app-cdr/recorder/
• Index of /pub/gentoo-portage/media-sound/skype-call-recorder/
• Index of /pub/gentoo-portage/media-sound/gnome-sound-recorder/

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>24) - mouse.genebee.msu.ru/ )

... June 25, 1996 . A Star Forming Region in the LMC . ... Explanation: Stars sometimes form in colorful ways. Pictured above is a small region in the nearby LMC galaxy where stars are forming. ... It may develop a strong wind which pushes away nearby gas ; it may be so hot and intense that emitted light boils away nearby dust and gas , and it may be so massive that it soon goes supernova and catapults its elements back to the interstellar medium . ... About APOD | ... Specific rights apply. ...

Еще в разделе: (Показать все результаты (>50) - www.arcetri.astro.it/ )

• APOD: June 16, 1998 - An Active Region of the Sun
• APOD: December 27, 1999 - Solar Moss
• APOD: 2000 July 20 - AR9077: Solar Magnetic Arcade

. Русский . Home News Program Committee Organizing Committee Program Plenaries Special Sessions Registration Abstracts Accommodation Important dates Contacts Poster Links Conference Venue Video . Video Records of Presentations . 2007 2008 Optimal Control Department, . CMC Faculty of Lomonosov MSU .

Еще в разделе: (Показать все результаты (>28) - pont2008.cmc.msu.ru/ )

... Главная -> Фильмы -> Gamera 2: Region shurai . ... Фильмы . ... Gamera 2: Region shurai . Гамора 2: Нападение космического легиона . ... Chris Anderson . ... Marty Fleck . Mary Fleck . ... Richard Hasenmyer . Steven Hasenmyer . Chris Hawley . ... Chris Nelson . ... Chris Patton . ... Разрушительная сила ?Легиона? сметает всељна своем пути. ... Спасти человечество вљрешающей безжалостной битве сљгигантской королевой ?Легиона? может только Гамора! [ klepa ] . ...

Еще в разделе: (Показать все результаты (>538) - kinfo.ru/ )

• The Limbic Region - Фильмы - Kinfo.ru
• Cadillac Records - Фильмы - Kinfo.ru
• World Record - Фильмы - Kinfo.ru

... 96-05-65519, отчет за 1997 год) . ... Dynamics of srtike-slip magmatic duplexes . ... During 1997, we conducted (1) field works in the South Ural area (for account of another financial sources), (2) theoretical investigations of the earlier studied strike-slip magmatic duplexes from Central Kazakhstan and the Kola-Karelian region, (3) analitical study of magmatic rocks composition (for account of another financial sources), and (4) development of computer databases and software. ...

Еще в разделе: (Показать все результаты (>17) - sbmg.geol.msu.ru/ )

• Sonenshain
• China
• Ссылки на сейсмотомографические сайты

... Finance - Currency Conversion . FXConverter - OANDA's 164 Currency Converter . ... PNAS Online -- Search Multiple Journals . ... Scirus - For Scientific Information Only . Molecular Biology Software . Education and Genetics: Human Genome Project Information . Journal of Computational Biology Table of Contents . LINK Alert Service - Subscribe . Springer LINK - Forum for Science . ... Genome Biol Vol. ... COMPUTATIONAL BIOLOGY . ... Journal Impact Factor 2000 . ...

Еще в разделе: (Показать все результаты (>109) - higeom.math.msu.su/ )

МГУ имени М.В.Ломоносова Русская версия . ... Russia, Orenburg . ... Russia, Orenburg region, Orenburg . Form of education . ... Add information about education . МГУ имени М.В. Ломоносова . ... 119991, г.Москва, Ленинские горы, д.1, Главное здание МГУ . ...

Еще в разделе: (Показать все результаты (>250) - conf.msu.ru/ )

• Yaroslavna Nikolaevna Dyogteva / МГУ имени М.В.Ломоносова
• Ульяна Сергеевна Никулина / МГУ имени М.В.Ломоносова
• Alina Olegovna Sushinskaia-Tetereva / МГУ имени М.В.Ломоносова

. Expedition region is marked by circle

Еще в разделе: (Показать все результаты (>503) - herba.msu.ru/ )

• Space map of the expedition region
• Publications with use of White sea expedition materials
• Algologia. Vol. 7, No. 2

. ЭКОЛОГИЧЕСКАЯ ИНФОРМАЦИЯ . WEB- ориентированная библиографическая база данных .

Еще в разделе: (Показать все результаты (>26) - ecoinformatica.srcc.msu.ru/ )

... Protein sequences . ... European ribosomal RNA database . ... Thermodynamic database for protein-nucleic acids interactions (Japan) . ... Families of structurally similar proteins . ... Database of protein families and HMMs (collection of multiple sequence alignments and hidden Markov models) . ... Collection of protein families constructed by clustering complete protein sequences. ... Database issues of NAR: vol. 31 (2003) , vol. 32 (2004) , vol. 33 (2005) , vol. 34 (2006) , vol. 35 (2007) , vol. ...

Еще в разделе: (Показать все результаты (>557) - monkey.belozersky.msu.ru/ )

• PDB entries containing domains of the family "Basic region leucine zipper"
• PDB entries containing domains of the family "Sigma-70, region 4"
• PDB entries containing domains of the family "XPG I-region"

MSU . ... Moscow State University Science Park is one of the first technology parks in Russia. The MSU Science Park was founded in accordance with the decision of Moscow State University s Academic Council: Record # 4 from 15 October 1990 . The founders of MSU Science Park were organizations such as M.W. Lomonosov Moscow State University and the Innovation Fund of the National Committee of Science and Technology, a division of the Ministry of Education and Science of the Russian Federation . ...

Еще в разделе: (Показать все результаты (>30) - www.sciencepark.ru/ )

... The role of intrinsically disordered regions in the structure and functioning of small heat shock proteins. ... Curr Protein Pept Sci. ... Small heat shock proteins (sHsp) form a large ubiquitous family of proteins expressed in all phyla of living organisms. ... Thus, disordered N- and C-terminal sequences play important role in the structure, regulation and functioning of sHsp. ...

Еще в разделе: (Показать все результаты (>35) - biochem.bio.msu.ru/ )

... Departments . ... Geology of Russia . ... The main lines of scientific investigations are regional geology of continents with the emphasis on investigation of geology of Russia and surrounding territories of Northern Eurasia; research of orogenesis and riftogenesis, recent tectonics, geodynamics and geology of the Mediterranean (Alpine) geosynclinal-orogeneous belt; quaternary geology ; geology of sea and ocean floor; geology of Precambrian; working out of the methods of ...

Еще в разделе: (Показать все результаты (>118) - www.geol.msu.ru/ )

1) Soil Science Faculty, Moscow State University, Moscow 119899, Russia; . ... We assessed critical loads of acid deposition and their exceedance for forest soils in the European part of the former Soviet Union using a simple balance method and mapped them within 1.0° в 0.5° longitude per latitude grid cells. ... The uncertainty in the estimated critical load values can be rather large due to uncertainty in critical chemical values for the soil as for a receptor, assessment method and data. ...

Еще в разделе: (Показать все результаты (>40) - eco.soil.msu.ru/ )

• Polluting metals in Russian terrestrial ecosystems: chemistry, dynamics, and
• Forest ecosystem data in Norwegian-Russian border area
• Koptsik G.N., et al. Response of pine forests to long-term air pollution at the

The QRegion class specifies a clip region for a painter. ... QRegion  ()  . ... QRegion  ( const QRect &, RegionType = Rectangle )  . QRegion  ( const QPointArray &, bool winding=FALSE )  . ... bool  isEmpty  () const . ... Returns TRUE if the region contains the rectangle r, or FALSE if r is outside the region. Returns a region which is this region XOR r. Returns a region which is the intersection of this region and r. Returns TRUE if the region is empty, or FALSE if it is non-empty. ...

Еще в разделе: (Показать все результаты (>229) - rtm-cs.sinp.msu.ru/ )

• Qt Toolkit - QPicture Class

... Наука >> Геология >> Общая и региональная геология | ... Написать комментарий . ... First International Conference on Sustainable Development in Karst Regions . ... FIRST INTERNATIONAL CONFERENCE ON SUSTAINABLE DEVELOPMENT IN KARST REGIONS будет проходить 24-27 августа 2001года. ...

Еще в разделе: (Показать все результаты (>514) - www.nature.web.ru/ )