... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Laboratory was organized in 1995. ... Electron microscopy (through the Dept. Of Electron Microscopy) - HU-11 and H-700 transmission electron microscopes; ultramicrotomes etc. ... Microscope station for UV-microirradiation (260-280 nm wavelength, diameter of the microbeam from 0.5 um) . ... Address : Department of Electron Microscopy, Belozersky Institute , Build. ... Moscow State University , Moscow,119992, Russia. Tel: +7(095)939-2084 . Fax: +7(095)939-2084 . ...
... Русский English . Background . ... The Faculty of Bioengineering and Bioinformatics, Lomonosov Moscow State University was founded in 2002 with the express purpose of training of highly qualified personnel for the universities, research institutes, medical companies and facilities, and pharmaceutical and biotechnology industries. ... Each of FBB students is to successfully complete and defend three yearly research projects, in bioinformatics, biochemistry, and bioengineering. ...
Running Apache on a heavily loaded web server, one often encounters problems related to the machine and OS configuration. ... Quick and detailed performance tuning hints for BSD-derived systems. ... Depending on the syntactic form of the TZ environment variable, these systems have several different algorithms to determine the local time zone (presumably compatible with something). ... This form delegates the knowledge of the time zone information to an external compiled zoneinfo file ( la BSD). ...
SVETKA, a program for analysis of different alignments . Back to the help page . ... Such a feature can look like " Leucine in the position 362 of the alignment of the entire family " and can, in many cases, be a "decision rule" to distinguish sequences from two sides of a tree branch. ... Comparing the alignment with an input tree (the tree may be entered by the user or reconstructed with the WPGMA algorithm), the program detects supporting positions of the alignment for every branch the tree. ...
... Главная . О центре . ... Научно-образовательный Центр компьютерного моделирования и безопасных технологий был создан при поддержке Федеральной целевой программы 'Интеграция' по разделу развития многопроцессорных вычислительных комплексов (супер-ЭВМ) коллективного пользования совместно с Российской академией наук в целях внедрения новейших вычислительных технологий, в частности, параллельных вычислений в области математического моделирования в фундаментальных научных исследованиях. ...
... по проблемам очистки промышленных (сильно загрязненных) сточных вод . ... УЛУЧШЕННЫЕ ОКИСЛИТЕЛЬНЫЕ ТЕХНОЛОГИИ В ЗАДАЧАХ ОЧИСТКИ СТОЧНЫХ ВОД. ... Однако промышленные сточные воды содержат много ядовитых веществ, которые могут отравлять бактерии на городских очистных сооружениях, поэтому такие воды требуют предварительной очистки перед сбросом их в городскую канализационную сеть. ... В районах, где имеется много соленой воды, на первый план выходит задача очистки воды от избытка солей (обессоливание)....
Using Site testing data for Adaptive Optics simulations Kislovodsk, October 2010 1Glen Herriot, 1David Andersen, 1Jean-Pierre VИran, 2Brent Ellerbroek, 2Luc Gilles, 2Lianqi Wang 1National Research Council Canada Herzberg Institute of Astrophysics 2TMT Project Office, Pasadena TMT.AOS.PRE.10.074.REL01 1 Outline TMT / NFIRAOS Site Testing Parameters and their value for Adaptive Optics Simulations ... TMT.AOS.PRE.10.074.REL01 9 What is the interest of Adaptive Optics in r 0 Seeing ? ...
[
Текст
]
Ссылки http://site2010.sai.msu.ru/static/doc/GHerriot_site2010.ppt.pdf -- 1942.1 Кб -- 18.10.2010 Похожие документы
... Об институте . История института . ... Дистанционный семинар повышения квалификации ?Методика проведения комплексного экзамена по русскому языку, истории России и основам законодательства РФ? ... II Международный научно-практический семинар ?Преподавание общеобразовательных предметов на русском языке в иноязычной аудитории? ... Летние курсы русского языка . ... Кафедра общеобразовательных предметов Института русского языка и . ... общеобразовательных предметов на русском языке в иноязычной . ...
... 000, 112 (2009) Printed 11 February 2010 A (MN L TEX style file v2.2) Analytical approximations of K -corrections in optical and near-infrared bands I1gor V. Chilingarian1 2 ,2,3 , Anne-Laure Melchior 1,4 and Ivan Yu. ... Received 2010 February 01; in original form 2009 August 14 ABSTRACT To compare photometric properties of galaxies at different redshifts, the fluxes need to be corrected for the changes of effective rest-frame wavelengths of filter bandpasses, called K -corrections. ... Table 1. ...
Инструкция по заполнению анкеты Заполнение в текстовом редакторе Microsoft Word следует начинать с анкеты ? ... 1 (Наукоемкий бизнес, Контрактные исследования, Консультационные услуги), заполните серые поля раздела Контактная информация и переходите к заполнению соответствующих разделов анкет ? ... АНКЕТА ? ... 3) Вы уже являетесь участником малой инновационной компании | ... профессиональной области: научные консультации, образовательные | ... Химия, химическая технология, новые материалы | ...
[
Текст
]
Ссылки http://www.innovation.msu.ru/Anketa.%20Technological%20audit.doc -- 102.0 Кб -- 14.10.2006 Похожие документы
... 2015 . ... Submit your article . ... The article discusses and analyzes the problems of institutionalization of public administration of customs affairs in different countries. The author justifies the importance of international experience in the formation of institutional mechanisms of public administration of customs system. ... No material published in this journal may be reproduced in print or in electronic form without a link to "E-journal. Public Administrarion". ...
... Пропустить Стоимость курсов . ... Порядок заключения договоров на обучение определен, вы можете с ним ознакомиться в курсе Заключение договоров и оплата курсов . Регистрируйтесь на сайте, изучайте первые бесплатные уроки и выбирайте курсы для дальнейшего изучения. ... Базовый курс. ... Этот курс рекомендуется брать после изучения курса Информатика. ... Дистанционные подготовительные курсы факультета вычислительной математики и кибернетики МГУ имени М.В. Ломоносова Пропустить Новостной форум . ...
... UHECR SINP MSU . ... News . ... TUS Ultra high energy cosmic ray detector on-board the Lomonosov satellite . ... According to existing estimations it can be a prominent source of ultra high energy cosmic rays (UHECR). ... In either case, the newly born magnetar is an attractive site for producing ultrahigh-energy cosmic rays (particles with individual energies exceeding 10 18 e V ; UHECRs). ... A new mechanism for the acceleration of ultra high energy cosmic rays (UHECR) is presented here. ...
. Strict Standards : Non-static method JLoader::import() should not be called statically in /wcmc/ms/ms/libraries/joomla/import.php on line 29 . Strict Standards : Non-static method JLoader::register() should not be called statically in /wcmc/ms/ms/libraries/loader.php on line 71 . Strict Standards : Non-static method JLoader::import() should not be called statically in /wcmc/ms/ms/libraries/joomla/import.php on line 32 . Strict Standards : Non-static method JLoader::register() should not be called
... Институт стран Азии и Африки МГУ . О кафедре . ... ИСАА МГУ . ... Малый факультет . ... Публикации . Публикации о ЦИЕЦ . Публикации преподавателей . ... Заведующий кафедрой . Ковельман Аркадий Бенционович . ... Объявлен новый набор на Малый Факультет Иудаики! ... Малый Факультет . ... Начало занятий Малого факультета Иудаики 16 сентября в 12.00 по адресу Большая Никитская, 47/3 . ... Фонд Ави Хай, Фонд Чейза, Фонд Ха Надив, Сохнут, Джойнт, Российский Еврейский Конгресс ...
... О практикуме . Баллы . ... 31.08.2012 04:12 / admin . Начала работать новая страничка практикума по базам данных. Здесь можно будет найти методические материалы, текущие баллы и оценки, а также другую полезную информацию. ... Комиссия по практикуму . Зачет по практикуму . ... SQL Server для практикума . Практикум в осеннем семестре . Информация о зачете . ... Декабрь 2014 . Декабрь 2013 . Октябрь 2013 . ... Декабрь 2012 . ... Copyright 2012-2013 - spprac.cs.msu.ru . ...