... To define in detail the molecular mechanism of NAD+-dependent formate dehydrogenase, the pH dependences of various kinetic and spectroscopic parameters have been studied: Vmax, Km (NAD+), Km (formate), inhibition constants for structural analogues of substrate (NO3-) and product (CNS-, CNO-, N3-), CD and fluorescence properties. The value of Vmax, rate-limiting hydride transfer, is nearly constant throughout the entire pH range of enzyme stability (6.0-11.2) but decreases below 6. ...

Еще в разделе: (Показать все результаты (>149) - www.enzyme.chem.msu.ru/ )

Contemporary interpretation of morphology as a way of obtaining new data on the ecology and evolution of vertebrates (exemplified by birds) Felix Ya. ... 1950, 1957, 19706, 1974, 1983), - . ... 1997) ".. ... 1974; , , 1977; , 1982, 1991; Korzun et al., ... 1957, 19706, 1983), . ... 1958, 1965; Bock, 1964; , 1972, 1982, 1997; , 1978; Zusi, 1984 ), , , - . Zusi, 1974) . ... 1961, 1965). ... 1974). ... 1965, . ... 19706,1974,1983). ... 1965, 1970; , 1972). ... 1982, . ... 1964, Vol. ... 1972, Vol. ...

Еще в разделе: (Показать все результаты (>58) - vertebrata.bio.msu.ru/ )

• Student Reports at International Conferences
• Выступления студентов и аспирантов на конференциях

... x264 is an open source codec of standard MPEG4 AVC/H.264, developed by programmers from all over the world. ... Accumulated during previous frames' compressions statistic is actively used by codec to improve effectiveness of adaptive models. ... These parameters are used only before encoding start, so, our improvements are more significant for short sequences. ... 3 Results of codec x264 modification on "flower" sequence . ... 5 Results of codec x264 modification on "flower" sequence, low bitrates ....

Еще в разделе: (Показать все результаты (>240) - graphics.cs.msu.ru/ )

• Algorithms for calculating parameters of virtual scenes in computer vision
• x264 codec improvement | Лаборатория компьютерной графики и мультимедиа
• Videocodecs tuning | Graphics and Media Lab

... public class Attribute . ... They have a name, type and an array of values. ... Attribute (java.lang.String name, double value) . ... If the value represents an array type, returns the Class object representing the component type of the array; otherwise returns null. int . ... Constructor Detail public Attribute (java.lang.String name, java.lang.Number value) . ... public Attribute (java.lang.String name, double value) . ... public Attribute (java.lang.String name, java.lang.Object theValue) . ...

Еще в разделе: (Показать все результаты (>98) - angel.cs.msu.su/ )

• : Class IndexIterator
• : Class ScalarMultiArray
• : Class ProtoVariable

Lomonosov Moscow State University was established in 1755 . ... Lomonosov Moscow State University Diary . ... MSU Web Sites . ... General Information . ... Study and Research . ... MSU Online . ... Research Priorities in Sciences at MSU: . ... MSU-RAS Research Institute of Soil Science . ... Research Priorities in Humanities at MSU: . ... Research Priorities in Social Sciences at MSU: . ... Research Priorities in the Humanities at MSU: . ... Research Priorities in Sciences and Humanities at MSU: . ...

Еще в разделе: (Показать все результаты (>201) - www.msu.ru/ )

• Lomonosov Moscow State University
• Institute of Asian and African Studies
• Faculty of Soil Science

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>11) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search
• About

The use of the external module ZnS_FeS.dll ZnS_FeS.dll file is an external module for the Gibbs program, and is designed to calculate the activity coefficients of the components of iron- bearing sphalerite (Zn,Fe)S. Using this module in the calculation of equilibria via HCh package programs provides better, more realistic results than when running the programs without it. A non-ideal model of sphalerite, proposed in literature [1], is used in this module. ... solutions from the System file. ...

Еще в разделе: (Показать все результаты (>86) - www.geol.msu.ru/ )

• http://www.geol.msu.ru/deps/geochems/soft/en/Electrum.doc
• http://www.geol.msu.ru/deps/geochems/soft/en/Ab_An.doc
• http://www.geol.msu.ru/deps/geochems/soft/en/2008.pdf

Tsunami source parameters versus earthquake magnitude and depth: Monte Carlo simulation Mikhail Nosov and Anna Bolshakova M.V.Lomonosov Moscow State University, Faculty of Physics, Moscow, Russian Federation (m.a.nosov@mail.ru) European Geosciences Union General Assembly 2011 Vienna | ... Among all possible parameters of a tsunami source we consider only those parameters which can be unambiguously calculated from the vertical component of co-seismic bottom deformations. ...

Еще в разделе: (Показать все результаты (>14) - ocean.phys.msu.ru/ )

• http://ocean.phys.msu.ru/courses/stathyd/2001%20Ferrari%20et%20al.%2C%20The%20temperature-salinity%20relationship%20of%20the%20mixed%20layer.pdf

About BAFIZ . ... BAFIZ is a program devoted to the development of a distributed network of the knowledge and data bases for research of fundamental properties of the matter and applied nuclear physics. The project sponsored by Russian Foundation of Basic Research , RFBR reference number is 95-07-19502. ... This Page is developed at Laboratory of Computational Mathematics, . ... Last updated on 2 September 1999 . Copyright 1999 Laboratory of Computational Mathematics (DRCM) ...

Еще в разделе: (Показать все результаты (>29) - dbserv.sinp.msu.ru/ )

• The Other BAFIZ Pages
• SW and GM conditions

... Querying File Parameters . Up: File Manipulation Next: File Info Previous: Querying the Size of a File . MPI_FILE_GET_GROUP(fh, group) . ... OUT group] group which opened the file (handle) . int MPI_File_get_group(MPI_File fh, MPI_Group *group) . MPI_FILE_GET_GROUP(FH, GROUP, IERROR) . ... MPI::Group MPI::File::Get_group() const . MPI_FILE_GET_GROUP returns a duplicate of the group of the communicator used to open the file associated with fh. ... MPI_FILE_GET_AMODE(fh, amode) . ...

Еще в разделе: (Показать все результаты (>581) - www.parallel.ru/ )

• MPI_Comm_remote_size | PARALLEL.RU - Информационно-аналитический центр по
• MPI_Comm_rank | PARALLEL.RU - Информационно-аналитический центр по параллельным
• MPI_Comm_size | PARALLEL.RU - Информационно-аналитический центр по параллельным

... Applications of Molecular Mechanics to Metal Complexes" . ... Molecular mechanics study of the mixed-ligand lanthanide complexes using Gillespie-Kepert model . ... Within MM-GK, the same parameters are applicable to complexes of different coordination numbers/polyhedra. ... Gillespie-Kepert model . ... Using derived computational parameters, we calculated the geometry of 39 lanthanide ion nonaaqua complexes, 6 octaaqua complexes and 18 beta- diketonate and aqua-beta-diketonate complexes. ...

Еще в разделе: (Показать все результаты (>32) - analyt.chem.msu.ru/ )

• Molecular Mechanics Calculations of beta-Diketonate, Aqua, And
• Conformational Analysis of Boron-Containing Compounds Using Gillespie-Kepert
• Moscow State University: Analytical Chemistry Division

... intrinsic fluorescence, diffuse reflectance and NIR spectroscopic imaging ? are combined as related to a multimodal approach in cardiovascular research and diagnostics. ... Both Kubelka-Munk and photon migration (PM) approaches theoretically describe diffuse reflectance, reabsorption and emission tracks in the tissue and were employed to support the reabsorption effect. ... Diffuse reflectance of a beating heart either in vivo or ex-vivo is monochromatically collected by CCD camera. ...

Еще в разделе: (Показать все результаты (>102) - www.msm.biophys.msu.ru/ )

Combination of high resolution mass -spectrometry (FT-ICR) and nuclear magnetic resonance ( NMR ) for analysis of mumijo (shilajit) Gleb Vladimirov1, Anton Grigoryev1,5, Alexey Kononikhin1,2, Norbert Hertkorn4, Andrey Konstantinov3, Irina Perminova3, Igor Popov1.2, Eugene Nikolaev1,2 Institute For Energy Problems of Chemical Physics RAS, Moscow , Russia Institute of Biochemical Physics RAS, Moscow , Russia 3 Lomonosov Moscow State University, ...

Еще в разделе: (Показать все результаты (>170) - mgumus.chem.msu.ru/ )

• http://www.mgumus.chem.msu.ru/publication/2008/2008-nikolaev-development.pdf
• http://www.mgumus.chem.msu.ru/publication/2008/2008-karpiouk-synthesis.pdf
• http://www.mgumus.chem.msu.ru/publication/2008/2008-sorkina-synthesis.pdf

Next: Items that Define Paths Up: The sendmail.cf File Previous: An Example sendmail.m4 File . A few or the items in the sendmail.m4 file are required all the time; others can be ignored if you can get away with defaults. The following sections describe each of the items in the example sendmail.m4 file in more detail. Items that Define Paths . Defining the Local Mailer . ... Domain Name Service Related Items . Defining Names the Local System is Known by . UUCP-Related Items . ...

Еще в разделе: (Показать все результаты (>314) - itpm.msu.su/ )

• Ethernet Autoprobing
• ITPM MSU Web Page
• Dealing with Bounced Mail

Backlinks to FormatTokens in System Web ( Search all webs ) . ... NEW - 14 Mar 2011 - 23:35 by ProjectContributor . ... Developer Documentation Application Developer Topics Topics for normal users that want to develop Foswiki applications. ... NEW - 10 Apr 2011 - 22:07 by ProjectContributor . ... The default output format of a %SEARCH{...}% is a table consisting of topic names and topic summaries. ... NEW - 27 Feb 2011 - 20:56 by ProjectContributor . ... Syntax In the example above .. ... Syntax: .. ...

Еще в разделе: (Показать все результаты (>7063) - wiki.cs.msu.ru/ )

• (backlinks in all Webs) FormatTokens < System < Foswiki
• PerlDoc < System < Foswiki
• (backlinks in System Web) RegularExpression < System < Foswiki

Using Site testing data for Adaptive Optics simulations Kislovodsk, October 2010 1Glen Herriot, 1David Andersen, 1Jean-Pierre VИran, 2Brent Ellerbroek, 2Luc Gilles, 2Lianqi Wang 1National Research Council Canada ­ Herzberg Institute of Astrophysics 2TMT Project Office, Pasadena TMT.AOS.PRE.10.074.REL01 1 Outline TMT / NFIRAOS Site Testing Parameters and their value for Adaptive Optics Simulations ... TMT.AOS.PRE.10.074.REL01 9 What is the interest of Adaptive Optics in r 0 Seeing ? ...

Еще в разделе: (Показать все результаты (>24) - site2010.sai.msu.ru/ )

• General information
• Methods and instruments to measure/monitor major site properties

Welcome , Registration , and other StartingPoints ; TWiki history & Wiki style; All the docs.. ... Line: 1 to 1 . ... Changed: . ... It should correspond to the format of the format parameter. ... Topic:* | ... FAQ\:[\n\r]*([^\n\r]+).*) [[$topic][Answer.. ... SEARCH{ "\.*" scope="topic" regex="on" nosearch="on" nototal="on" order="modified" reverse="on" format="| [[$topic]] | ... SEARCH{ "\.*" scope="topic" type="regex" nosearch="on" nototal="on" order="modified" reverse="on" format="| [[$topic]] | ...

Еще в разделе: (Показать все результаты (>37591) - dualopt1.cmm.msu.ru/ )

• IncludeTopicsAndWebPages - TWiki - TWiki - (printable)
• VarURLPARAM - TWiki - TWiki
• VarURLPARAM - TWiki - TWiki - (printable)

... Географии мирового хозяйства . ... География" . ... Use the form below to propose a session for the IGU Regional Conference . ... Evolution of Earth Cryosphere in changing climatic conditions and under a human-induced disturbances . ... Monitoring of cryosphere components is essential in understanding climatic and environmental variability and trends. The complexity of cryosphere is attributed to variable reaction of its components (glaciers, permafrost, snow) on changing climatic conditions. ...

Еще в разделе: (Показать все результаты (>280) - www.geogr.msu.ru/ )

• CONTENT 2 (8) 2015
• CONTENTS ? 4 - 2015
• CONTENT 4 (5) 2012

... solvation nucleation of the polymorphs Solute-solute interactions, association parameters , thermodynamics parameters , conformations growth of the crystal Nature of solvent, intermolecular interactions (solute ­ solvent, solute-solute), conformations Lattice energy , entropy of the crystal, symmetry of the lattice, conformations The conformational manifolds is the candidate to be a coordinate of reaction Methods of investigations Quantum chemistry ...

Еще в разделе: (Показать все результаты (>22) - www.elch.chem.msu.ru/ )

• http://www.elch.chem.msu.ru/mole/lecture/basilevsky.pdf

... Новости . ... Музей . антропологии . ... Вестник МГУ Антропология . ... 26 ноября Музее антропологии открылась этнографическая выставка . ... Антропология" . ... Посмотреть фотографии . ... 2008-2010 Научно-исследовательский институт и Музей антропологии им.Д.Н.Анучина . Копирование материалов web-сайта только с разрешения администрации НИИ и Музея антропологии МГУ! ... При использовании материалов, размещенных на сайте НИИ и Музея антропологии МГУ, ссылка на источник обязательна! ...

Еще в разделе: (Показать все результаты (>31) - www.anthropos.msu.ru/ )

• НИИ и Музей антропологии | Вестник Московского университета. Серия XXIII.