Prediction of physical properties of materials based only on their chemical composition has long been an intriguing task. ... The main interests of Prof. Lebedev 's group are physical properties of crystals exhibiting structural instability, in which different phase transitions (including the ferroelectric one) can appear. ... A.I. Lebedev. ... Physics of the Solid State 51 , 362 (2009) ; e-print arXiv:1305.0240 (2013) ; [local copy] . ... Physics of the Solid State 51 , 2324 (2009) ; [local copy] . ...

Еще в разделе: (Показать все результаты (>84) - scon155.phys.msu.su/ )

... Полная версия этой страницы: Работа в Samsung . Студенческий форум Физфака МГУ > Общий > Работа . ... Telecommunication Network . ... Job Summary: The Optical Engineer will be involved in the design, fabrication and testing of optical/digital imaging system for mobile devices. ... Required Skills: Must have proven optical design and algorithm skills, lens design experience using code-V or equivalent lens design software. ... Company: Samsung Electronics Telecommunication Network Business . ...

Еще в разделе: (Показать все результаты (>1359) - wasp.phys.msu.ru/ )

• Студенческий форум Физфака МГУ > Работа в Германии
• Работа в Samsung - Студенческий форум Физфака МГУ

... Meetings/Murray . ... Тема: FreeBSD in the Enterprise: An Introduction for Linux Users . ... Freely available Unix-like operating system . ... Redistribution of source code must retain the above copyright notice, this list of conditions, and the disclaimer. ... The source tree can be checked out at any state, or corresponding to any release . ... Some wireless hardware vendors refuse to release specifications, so this is the only method to use such cards with an open source operating system. ...

Еще в разделе: (Показать все результаты (>393) - uneex.mithril.cs.msu.su/ )

• HelpOnNavigation - UNИX
• HelpOnParsers/ReStructuredText - UNИX
• eSyr/BuildSystemsCoursePlan/010Exec - UNИX

... M.V.Lomonosov Moscow State University . ... In the year 2005, the world leader in the area of information technologies - SAMSUNG Electronics - announces the launching of two educational programs: . ... Genius Scholarship Program at the Seoul National University (GSP-SNU Program) (Samsung Engineering Program) for the Master of Sciences (M.Sc.) ... Genius Scholarship Program at the Sungkyunkwan University (GSP-SKK Program) (Samsung MBA Program) for the Master of Business Administration (MBA) Degree . ...

Еще в разделе: (Показать все результаты (>211) - phys.msu.ru/ )

• Кафедра компьютерных методов физики

INTERNET TECHNOLOGIES AND NEW CONCEPTION OF WDCs SYSTEM P.Yu.Pletchov, (Computer Center, RAS, Moscow, Russia, E-mail: lym@ccas.ru) Yu.S.Tyupkin (National Geophysical Committee of Russia Federation and Geophysical Center of RAS, Moscow, Russia, E-mail: tyupkin@wdcb.rssi.ru) In this technical report we wish to discuss the problem of setting up the distributed information system as a part of new conception of World Data Centers system. ... 4) Editing descriptions of an information resource by user. ...

Еще в разделе: (Показать все результаты (>744) - geo.web.ru/ )

• Авторский сайт Владимира Мальцева - литература
• COMAGMAT MODEL

... Форумы > Аспирантура > Тема . ... MSc/PhD in Computer Science at Clemson University . We are looking for an outstanding candidate for a Ph.D. position in the School of Computing at Clemson University, starting summer or fall 2014. ... The School of Computing has 42 faculty members, more than 400 undergraduate majors, and over 200 graduate students collectively across its three divisions: Computer Science, Visual Computing, and Human-Centered Computing. ... School of Computing . ...

Еще в разделе: (Показать все результаты (>6625) - www.mmonline.ru/ )

• MMOnline | Форумы | Аспирантура | Internship, PhD program, and PhD exchange
• MMOnline | Форумы | Разное | Программисты
• MMOnline | Форумы | Разное | Требуется Web - дизайнер.

... This course focuses on main characteristics of the ?life? of academic information (its development and diffusion), and on basic algorithms of data retrieval. ... This course consists of four interrelated areas: theoretical introduction (Internetics and information theory), and practical units including the three pillars of information retrieval services: factual, bibliographic and documentary search. ... Factual search. ... Internet-heuristics strategies: summarizing information retrieval skills . ...

Еще в разделе: (Показать все результаты (>253) - hist.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>26) - mouse.genebee.msu.ru/ )

... One of the project objectives was to investigate practical efficiency of some modern iterative methods, including multigrid techniques and domain decomposition methods as well as methods for small compressible materials. ... Hence, the project research initiated because of INTAS financial support contributes in setting up modern computational techniques in tire design. ... Research on efficiency of iterative methods was conducted at the department of Mechanics of Composites about ten years ago. ...

Еще в разделе: (Показать все результаты (>3) - composite.msu.ru/ )

... Memory is a key resource in desktop computer. ... 2016 С Днем Победы! ... win 7 ultimate product key Windows 8 key windows 7 key win 7 key windows 7 pro product key win 7 pro product key windows 7 activation key windows 7 ultimate product key windows 7 ultimate serial key windows 7 key online win 7 ultimate key win 7 serial keys Win 7 ultimate key Win 7 ultimate product key windows 7 key sale win 7 ultimate product Key Windows 7 key ultimate win 7 ultimate ...

Еще в разделе: (Показать все результаты (>228) - elana.sinp.msu.ru/ )

• michael kors outlet uk who owned and operated the Freedom Hosting service

... Subject to the MOIP Charter both natural and legal persons may become the members of the Society upon paying admission fees and acknowledging the Charter and program documents. ... Persons may be elected as the Society?s full and corresponding members on a show of hands at the Society?s Council (Presidium) meeting if nominated by a section and recommended by at least two full Society?s members. ... The Society?s full members have the following rights: . ... 2015 Moscow Society of Naturalists . ...

Еще в разделе: (Показать все результаты (>7) - www.moip.msu.ru/ )

... In particular, Jmol.js uses the split version. ... To invoke JmolApplet.jar from Jmol.js, either: a) put it in the folder containing the HTML page requiring it and do not use jmolInitialize() or b) identify it explicitly in jmolInitialize(), for example: jmolInitialize("folder-containing-jar-files", "JmolApplet.jar") - JmolAppletSigned.jar An equivalent version of the applet, but this is a "signed" or "trusted" applet (a term in Java security language). ...

Еще в разделе: (Показать все результаты (>121) - monkey.belozersky.msu.ru/ )

• About this project
• HTH_3_main

... The RADEN data bank produced at the Department of Chemistry of Moscow State University is designed as well to accumulate published information on radiative parameters of diatomic molecules, as to analyse it and recommend the more reliable values. ... electronic transition moments D ( R ); . ... dipole moments, . ... FACTUAL RECOMMENDED DATABASE contains now the ab initio and experimental electronic transition moments for more than 250 band systems which belong to more than 100 diatomic molecules. ...

Еще в разделе: (Показать все результаты (>83) - electr003.chem.msu.ru/ )

... Inside the computer's microprocessor chip, a clock distribution system delivers the timing signals from the crystal oscillator to the various circuits, just as sound in air delivers the beat of a drum to soldiers to set their marching pace. ... Beat the Clock . ... Now researchers are designing asynchronous systems that can process data without the need for a governing clock. ... Without a clock to govern its actions, an asynchronous system must rely on local coordination circuits instead. ...

Еще в разделе: (Показать все результаты (>506) - chronos.msu.ru/ )

• The biotic conception of aquatic ecosystem control