... The subjects of the Colloquium-458 cover important problems dealing with the verification of constitutive equations, the organization of experiments, the connection between microstructures and mechanical properties and the effective utilization of the modern FEM packages. ... Institute of Mechanics, Lomonosov Moscow State University, Michurinsky Prospekt, 1, 117192, Moscow, Russia . ... S.-Petersburg, 195251, Russia. ... Institute for Problems in Mechanics of Russian Academy of Sciences . ...

Еще в разделе: (Показать все результаты (>2) - www.imec.msu.ru/ )

• EUROMECH Colloquium-458

... I mean the following Theorem If any local eld (x) is irreducible and [ (x), (y )] = B (x - y ), (1) then operator B (x) is multiple of unit operator, that is (x) is an asymptotic eld. ... Our result is most interesting in the case of noncommutative theory, precisely, in the case of space-space noncommutativity, in which time commutes with spatial variables and, as a consequence, one spatial variable, say x3, commutes with others. ... For simplicity we consider the case of neutral scalar elds. ...

Еще в разделе: (Показать все результаты (>155) - qfthep.sinp.msu.ru/ )

• http://qfthep.sinp.msu.ru/talks2013/POZDEEVAQFTHEP13.pdf
• http://qfthep.sinp.msu.ru/talks2015/Ginzburg_Samara.pdf
• http://qfthep.sinp.msu.ru/talks2015/Chesnokov_QFTHEP%202015.pdf

... N.5, pp.592-597 (scanned PDF file, English version) . ... A.V.Shanin, Embedding formula for electromagnetic diffraction problem // Zapiski seminarov POMI, V.324, pp.247-261 (2001), in Russian, (PDF file, Russian version) (PDF file, English version) . ... PDF file) . ... Shanin A.V., Coordinate equations for the Laplace-Beltrami problem on a sphere with a cut // QJMAM, 2005 (58) 2, 1-20 The preprint versions of two previous papers have been sent to URSI contest: Paper 1, PDF file , Paper 2, PDF file ...

Еще в разделе: (Показать все результаты (>56) - acoustics.phys.msu.ru/ )

... International conference . Topology, analysis and applications to mathematical physics . ... 14-19 February 2005 . ... 6-10 June 2005 . ... Pure and Applied Algebraic Topology . ... International Conference . ... 26 June-2 July 2005 . ... Conference on Algebraic Topology . ... The 6th Iberoamerican conference on topology and its applications (CITA-2005) . ... 4-7 July 2005 . ... Topology ATLAS: Conferences and Seminars . British Topology conference list (maintained by Sarah Whitehouse) . ...

Еще в разделе: (Показать все результаты (>345) - higeom.math.msu.su/ )

• Index of /teaching/students/introtop
• Index of /~asmish/Lichnaja-2010/Version2010-11-20/UchProcess-2009

FAQ: QUESTIONS ASKED BY NOVICE USERS (c) Australian Geological Survey Organisation 1999-2002 (c) Yuri Shvarov 1999-2002 Last updated: 3 May 2002 This file does not substitute for the comprehensive HCh documentation. ... 2 UNITHERM USAGE 2.1 UNITHERM DATABASE 2.1.1 What is the guaranty that the included UNITHERM database has no incorrect entries? ... User's Guide. ... You can speed up your calculations for aqueous systems in a "manual" calculation mode of GIBBS when using Blank or Input files. ...

Еще в разделе: (Показать все результаты (>92) - www.geol.msu.ru/ )

• http://www.geol.msu.ru/deps/geochems/soft/en/GibbsLib.doc
• "Смирновский Сборник". Кафедра геологии и геохимии полезных ископаемых
• Download Yuri Shvarov's files

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>13) - mouse.genebee.msu.ru/ )

• ConClus
• Align tool for DNA-protein complexes

... Tajikistan . Even before independence Tajikistan was the poorest of all the Soviet republics. ... However, official information on the level and patterns of income and expenditures suggests that poverty is a severe problem in Tajikistan. ... The empowerment of the poor and their participation in the process of development are critical for both reducing poverty and sustaining future growth. ... International assistance in the long-term is aimed at the sustainable development of local capacity. ...

Еще в разделе: (Показать все результаты (>167) - www.prof.msu.ru/ )

• Task Force for International Women in American Studies
• Fulbright Program in Russia: Prospects and Problems of the Community of...
• About the importance of founding teleecommunication centres in developing areas

... By the early 1990s, the distances between IC components became incredibly small, and the relative effect of the interconnect delay became a greater portion of the overall signal propagation delay. ... Replacement of traditional Al by low resistivity Cu decreases RC delay. ... Different types of low-k materials have been considered. Relatively fast developed organosilicate (OSG) based low-k materials met significant challenges during their integration because of their porous structure. ...

Еще в разделе: (Показать все результаты (>171) - polly.phys.msu.ru/ )

• International Workshop "Theory and Computer Simulation of Polymers: New

DOI: 10.7256/2222-1972.2014.5.14682 doi « »: ( ) : . ... 526 © NOTA BENE ( «-») « » XI ., ... 527 © NOTA BENE ( «-») : 5 (23) · 2014 DOI: 10.7256/2222-1972.2014.5.14682 . ... XVI­XVIII . ... NOTA BENE ( «-») DOI: 10.7256/2222-1972.2014.5.14682 , [1, 7]. ... 529 © NOTA BENE ( «-») : 5 (23) · 2014 DOI: 10.7256/2222-1972.2014.5.14682 ­ , : « , " "». ... NOTA BENE ( «-») DOI: 10.7256/2222-1972.2014.5.14682 , « » [14, 155]. ... NOTA BENE ( «-») 533 : 5 (23) · 2014 DOI: 10.7256/2222-1972.2014.5.14682 27. ...

Еще в разделе: (Показать все результаты (>4344) - www.hist.msu.ru/ )

... Department of Mathematics, . Faculty of Physics, MSU . ... Mathematical analysis 2 . Numerical Methods (A.N. Bogolyubov) . ... Asymptotic methods in nonlinear problems of mathematical physics . ... Extremal problems . ... Methods of finite differences in mathematical physics . ... 13 th Annual workshop will be organized by the of Department of Mathematics of Physics Faculty at Moscow State University , Moscow, Russia. ... Department of Mathematics, Faculty of Physics, Lomonosov MSU 2014-2016 ...

Еще в разделе: (Показать все результаты (>10) - math.phys.msu.ru/ )

... What is the author's opinion on the problem? ... Organize the following parameters into 3 groups: content, organization, presentation (performance) · Body-language and eye contact · Fluency · Proper intonation and pronunciation · Relevant information and examples provided · Conclusion · Key concepts explained\defined · A range of complex grammatical structures and academic vocabulary · Key points emphasized · Introduction · Various linking devices, the transition from one point to the ...

Еще в разделе: (Показать все результаты (>23) - www.eng.math.msu.su/ )

• http://www.eng.math.msu.su/download/theses1.pdf

... Таня Трубичева, Коля Чеботарев, Сергей Меженный, Андрей Лебедев . ... Слева направо: Паша Зинюков, Булат Мавлюдов, Галя Ивутина (выше), Муся Григорян, Саша Игнатьев. ... Слева направо: 1)Аня Ноздрачева, 2)Дима Китаев, 3)Миша Ноздрачев, 4)Женя Цибиков, 5)Костя Фирсов, 6)Володя Трифонов, 7)Тамара Голубицкая, 8)Таня Михайлина, 9)Саша Игнатьев, 10)Валя Рябинкина, 11)Таня Чеботарева, 12)Оля Гусева, 13)Коля Чеботарев. ... Таня Гужва, Таня Немченко, Даниэль Усиков перед спуском в снежную . ...

Еще в разделе: (Показать все результаты (>9) - optics.sinp.msu.ru/ )

... Scientific directions . ... The research of the department of General Problems of Control has taken four major directions, each of which has several branches. ... general Lagrange principle, problems of convex analysis and methods of duality in the theory of extremal problems . ... free-boundary problems . ... Optimization, optimal control, numerical methods and questions of applied mathematics: . ... 119992 Moscow, GSP-1, Leninskie Gory, MSU, mechanics and mathematics department, OPU, Room 13-14 . ...

Еще в разделе: (Показать все результаты (>132) - new.math.msu.su/ )

• Seminars of the department | Department: General Problems of Control. Faculty
• Current staff list | Department: General Problems of Control. Faculty of
• Extra courses of the department | Department: General Problems of Control.

Literature . ... Computers and Statistical Data Analysis. ... In Russian. ... Basic notions and methods of applied statistical analysis and usage of leading Russian and American statistical software tools: STADIA, STATGRAPHICS. ... The second edition has much more detailed depiction of temporal series analysis methods, review of statistical packages for Windows and recommendations on their choosing. ... Kulaichev A.P. Data Analysis Methods And Tools for Windows . ... In English and In Russian. ...

Еще в разделе: (Показать все результаты (>3) - statsoft.msu.ru/ )

About SPAW Editor . ... As of final version 1.0 of the control you'll need to rename the file spaw_control.default.config.php in config sub-directory to spaw_control.config.php when installing control for the first time. ... All of the SPAW Editor configuration options are located in the config/spaw_control.config.php file. ... This file will be included in img_library.php (Image library dialog script). $request_uri variable will be set to the URL of the page where SPAW Editor instance resides. ...

Еще в разделе: (Показать все результаты (>81) - textbook.sinp.msu.ru/ )

extra:main ]] . CompHEP . ... Script for including cuts, kinematics, or regularizations into batch.dat file . Script for CompHep cross-sections energy dependence calculation . ... When you done CompHep calculations for the process under study at one energy, you may easely get cross-sections energy dependence running script cs_energy_dep.pl . ... For every energy point the script modifies results/batch.dat file and runs CompHep script num_batch.pl to calculate given process cross-sections. ...

Еще в разделе: (Показать все результаты (>31) - comphep.sinp.msu.ru/ )

• install [CompHEP]
• faq [CompHEP]
• new-mac [CompHEP]

... Only by numerical simulation. ... moment T (K) Dipole moment (D) Experiment Other example: Diffusion constant 200 250 298 350 400 2.40 2.37 2.48 2.59 2.80 2.25 The Distribution functions: radial distribution function 1 g (r) = N t =1 j i N TS N pair ( r - rij ) The Distribution functions: radial distribution function CC def 2 Work mode ­ computer related 1) · Perform simulation , create trajectory file · Calculate properties timestep by timestep 2) · Perform ...

Еще в разделе: (Показать все результаты (>18) - www.elch.chem.msu.ru/ )

• http://www.elch.chem.msu.ru/mole/lecture/qantipov.pdf
• http://www.elch.chem.msu.ru/mole/lecture/nazmutdinov.pdf

... Download NPG-explorer . ... Build nucleotide pangenome . ... Here we provide a table for 3 Brucella genomes: all: embl :CP002459 BRUMM chr1 c Brucella melitensis M28 chromosome 1 all: embl :CP002460 BRUMM chr2 c Brucella melitensis M28 chromosome 2 all: embl :CP003176 BRUAO chr1 c Brucella abortus A13334 chromosome 1 all: embl :CP003177 BRUAO chr2 c Brucella abortus A13334 chromosome 2 all: embl :CP002078 BRUPB chr1 c Brucella pinnipedialis B2/94 chromosome 1 all: ... Fix bugs....

Еще в разделе: (Показать все результаты (>7256) - mouse.belozersky.msu.ru/ )

• Geometrical core

Mathematical Modeling of Complex Information Processing Systems 119 OPTIMAL CONTROL IN THE PROBLEM OF UNPACKING A SPACE TELESCOPE MIRROR V. V. Alexandrov 1 , D. I. Bugrov 1 , B. A. Khrenov 2 , S. S. Migunov 1 , and L. Gomez Esparza 3 The problem of optimal control in the processes of unpacking a space telescope­detector is considered. ... The coordinate system Oxyz associated rigidly with the segments is obtained by the rotation of the system Ox 1 y 1 z 1 about the axis Oz 1 by an angle '. ...

Еще в разделе: (Показать все результаты (>84) - num-anal.srcc.msu.ru/ )

• http://num-anal.srcc.msu.su/eng_math/redict/8.htm

The most up-to-date information related to atmos 3.0 are collected here due to constantly increasing interest to MASS/DIMM processing software... atmos 3.0 is still beta , so the latest version is 2.97.5 (there is also 2.98.x branch which absorbs new features) . ... M' line: . ... free seeing and its relative error . ... dimm seeing and its relative error (if dimm data are present, zeros otherwise) . ... dimm turbulence power and its relative error (if dimm data are present, zeros otherwise) . ...

Еще в разделе: (Показать все результаты (>36) - curl.sai.msu.ru/ )