... Department of Vertebrate Zoology . Department of Vertebrate Zoology is one of the oldest departments of the Biological Faculty of Lomonosov Moscow State University. ... The students improve their practical skills in the courses of Microtechniques, Computer Methods in Biology and Methods of Field Research. ... The Department includes five research laboratories. ... Laboratory of Vertebrate Behaviour conducts research on the development of behavioural interactions in the higher vertebrates. ...

Еще в разделе: (Показать все результаты (>56) - vertebrata.bio.msu.ru/ )

• Research
• Laboratory of Ecology of Terrestrial Vertebrates
• Laboratory of Ornithology

General Information . ... Program . ... Symposium expenses . ... Presentation information . ... Cultural Program . Travel information . Contact information . 14 European Symposium on . Gas Phase Electron Diffraction . 24-28 June 2011 . ... On 26 June 2011 there will be a bus excursion around Moscow city including a walking excursion inside the Kremlin. ...

Еще в разделе: (Показать все результаты (>8) - ged.chem.msu.ru/ )

SPIE - The International Society for Optical Engineering Ukrainian and Russian Chapters First Announcement/Call for Papers The Seventh International Conference Correlation Optics The Sixth International Conference on Correlation Optics will be held in Chernivtsi , Ukraine on September 6-9, 2005 The purpose of the conference is to provide a discussion of novel approaches and advances connected with optical ... A list of preliminary prices for proposed hotels is given below. ...

Еще в разделе: (Показать все результаты (>144) - phys.msu.ru/ )

• http://phys.msu.su/rus/international/intl-trips-abroad/Fact%20Sheet%20for%20International%20Exchange%20Partners%20and%20Students%20Spring%20Semester%202016.pdf
• http://phys.msu.su/upload/iblock/941/gp2012appform.doc
• Гумбольдтовская лекция на физфаке

Title Author Key words The correlation between basic definitions of the word "meaning" and forms of human activity: the problem formulation G.P. Smirnov meaning, activity, interaction, behavior, values, needs The article states an attempt to adjust the views on the forms and levels of human activity and possible interpretations of the notion of «meaning». Author offers to give three definitions of the word "meaning" according the general scheme of human activity, which includes three levels. Abstract

Еще в разделе: (Показать все результаты (>45) - www.socio.msu.ru/ )

• English version - Социологический факультет МГУ

Home . Database of structures of nucleic acid - protein complexes . ... List of complexes . Pfam families . SCOP families . Interaction classes . ... NPIDB . ... Information on SCOP and Pfam domains detected in protein chains is presented. ... Each family has its own web page with the list of entries that include domains of the family. ... List of SCOP domains occurred in DNA-protein and RNA-protein complexes is organized in tree-like form, according to the SCOP classification. ...

Еще в разделе: (Показать все результаты (>3) - npidb.belozersky.msu.ru/ )

... A This result can be applied to a wide variety of data sets, including electricity bills1, street addresses, lengths of rivers, physical and mathematical constants, and processes described by power laws. ... Based on the plausible4 assumption that people who make up figures tend to distribute5 their digits fairly uniformly, a simple comparison of first-digit frequency distribution from the data with the expected distribution according to Benford's law had to show up any anomalous results. ...

Еще в разделе: (Показать все результаты (>21) - www.eng.math.msu.su/ )

Division Information . ... Site Information . ... Analytical Chemistry Division at the Department of Chemistry, M. V. Lomonosov Moscow State University is the leading Russian center in analytical science and education . ... Division comprises of 5 research laboratories and education lab facilities. ... Postal address: Analytical Chemistry Division, Department of Chemistry, Lomonosov Moscow State University, Leninskie Gory 1, 119899 Moscow, Russia . ... Chemistry Department of Moscow State Univesity . ...

Еще в разделе: (Показать все результаты (>29) - analyt.chem.msu.ru/ )

... International Studies . ... Admission for International Students . ... For Students . ... General Russian Courses . ... The Faculty of Foreign Languages and Area Studies at Moscow State University offers courses of General Russian to learners of all levels from Absolute Beginners through to Advanced. ... Beginners I - This course aims to help the student to acquire some knowledge of basic Russian, so that s/he can communicate with Russians, using basic vocabulary and grammar to express him/herself. ...

Еще в разделе: (Показать все результаты (>100) - ffl.msu.ru/ )

• Иностранным гражданам
• About Us

. Mailing List . To subscribe our list you need only to send a message for our server using its address like follows: . lists@rssh.net . In your message you should write: . subscribe humlang <name of a subscriber> <his affiliation> . After that you will be informed that you have been included in the list of HUMLANG subscribers. Also you will be provided with an address for sending messages to the HUMLANG List. [ back ][ main page ] .

Еще в разделе: (Показать все результаты (>59) - old.philol.msu.ru/ )

• Footnotes

A numerical algorithm and a computer system for the analysis of rheological schemes" . Zintchenko V.A., Sadovskaya O.V., Sadovskii V.M. We construct an algorithm for computing the material stress and strain diagrams on the basis of rheological schemes with an arbitrary level of complexity. In the case of simple schemes, including elastic and viscous elements, the corresponding system of linear ordinary differential equations is solved by an implicit method. ... PDF (in Russian) (552KB) . ...

Еще в разделе: (Показать все результаты (>358) - num-meth.srcc.msu.ru/ )

• "GRID and computational chemistry"
• "An accelerated topology change algorithm for the contour advection method"
• Numerical Methods and Programming.Advanced Computing

... Полная версия этой страницы: Чтение в массив строк . Студенческий форум Физфака МГУ > Физфак и учеба > Экзамены, зачеты, лекции, семинары, физпраки . ... надо считать их в массив строк.На Си. ... int main (int argc, char *argv[]) { . ... char data[255]; . ... char string_c[255][2048]; . ... массив размером 2048 на 255: 2048 макс строк в нем и 255 символов в строке. это не прога а полуфабрикат, добавь проверку на невылазанье из границы массива . ... char * tmpstr;//Заводим временную строку . ...

Еще в разделе: (Показать все результаты (>1888) - wasp.phys.msu.ru/ )

• Студенческий форум Физфака МГУ > Theoretical PhD studies, PhD positions for
• Студенческий форум Физфака МГУ > Старые добрые mex-фукции
• Студенческий форум Физфака МГУ > Software Developer

... Master Education . ... Master programs . ... objects, development and application of advanced mathematical methods and software to address problems in science, technology, economics and management.The Mathematics and Information Technology for Economic Activity Master ?s programme aims to prepare professionals in economics and finance ... This program aims to prepare high-qualified professionals for the commercial and government organizations in economics and the finance, including: . ...

Еще в разделе: (Показать все результаты (>18) - hcs.cmc.msu.ru/ )

• Master program "Mathematical and computer methods of image processing" |
• Master program "Information Security and Cryptography" | Магистерское и
• Master program "Enterprise Information Systems" | Магистерское и послевузовское

... Alternative core new atoms (%) . ... An alignment of a set of structures is a set of positions , to each position some atoms from different structures correspond. ... Geometrical core of a set of structures is a subset of alignment positions those atoms are disposed similarly in all structures. ... For any two positions included into geometrical core, the distances between CA atoms of those positions in all structures may differ not more than the value of the parameter "Distance spreading". ...

Еще в разделе: (Показать все результаты (>11) - mouse.belozersky.msu.ru/ )

• S : rm_systems

LM-KnB - the knowledge base on molecular genetics mechanisms controlling human lipid metabolism. ... At present LM-KnB includes several types of data. 1) The data from the GenNet database [1] concerning molecular genetics mechanisms, which control the intracellular cholesterol level: cholesterol biosynthesis, cholesterol uptake by cells and reverse cholesterol transport. ... 2002) GeneNet: a database on structure and functional organization of gene networks, Nucleic Acids Res., ...

Еще в разделе: (Показать все результаты (>241) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/42.pdf
• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/163.pdf
• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/115.pdf

Arthropoda Selecta 19(2): 101-102 ї ARTHROPODA SELECTA, 2010 Inermocoelotes Ovtchinnikov, 1999, a valid genus (Aranei: Amaurobiidae: Coelotinae) Inermocoelotes Ovtchinnikov, 1999 валидный род (Aranei: Amaurobiidae: Coelotinae) Kirill G. Mikhailov К.Г. Михайлов Zoological Museum, Moscow State University, Bolshaya Nikitskaya Str. ... ABSTRACT: A new synonymy is established: Eurocoelotes Wang, 2002 = Inermocoelotes Ovtchinnikov, 1999, syn.n. The rank of the latter taxon is elevated tothe genus level. ...

Еще в разделе: (Показать все результаты (>1531) - zmmu.msu.ru/ )

• Plecotus - Long-eared bats
• Familial-level divergence of Cistugo - abstract
• RAPDs in representatives of the genus Sorex, including chromosome races of

SELECT data_key, data_value FROM xf_data_registry WHERE data_key IN ('options', 'languages', 'contentTypes', 'codeEventListeners', 'cron', 'simpleCache', 'routesPublic', 'bannedIps', 'styles', 'nodeTypes', 'smilies', 'bbCode', 'displayStyles', 'trophyUserTitles', 'reportCounts', 'moderationCounts') . Run Time: 0.000535 . Select Type . ... Type . ... SIMPLE . ... PRIMARY . ... const . ... library/XenForo/ Autoloader.php . ... library/Zend/Registry.php . ... library/Zend/Db/Select.php . ...

Еще в разделе: (Показать все результаты (>25) - osk.msu.ru/ )

• http://osk.msu.ru/forum/forums/faq.8/?_debug=1
• http://osk.msu.ru/forum/help/bb-codes?_debug=1
• http://osk.msu.ru/forum/members/aaplicagf.1452/?_debug=1

... Resources . ... Eurasian Center . for Food Security . Home About About Eurasian Center for Food Security . ... Our mission: €аPromote and coordinate collective actions for strengthening food security in Eurasia through research and development. ... The ECFS Mission should be creating conditions for the development and implementation of a coherent agricultural policy that ensures soil fertility, conservation of natural resources and ensuring food security of the Eurasian region. ...

Еще в разделе: (Показать все результаты (>21) - ecfs.msu.ru/ )

• Online Consultation on Network and Partnerships in the area of Food Security |
• Draft Plan of Action for Eurasian Subregional Partnership | ECFS
• Economic Department | ECFS

To see a Russian version of this page, click here . ... Graduated from Moscow State University (MSU), Faculty of Physics in 1976. Ph.D. degree - 1988, MSU. Main field of scientific activities: photometric investigations of various stars, close binary stellar systems and other astronomical objects, including research with use of fast photoelectric photometry with a high time resolution till 1 millisecond. ... New portable photometer . ... Send your mail to: tem@sai.msu.ru ...

Еще в разделе: (Показать все результаты (>17) - uranus.sai.msu.ru/ )

• Irina Glushneva
• Victor Oknyanskij

... Alignment Sequence . Include picture . No Picture Only Structure Structure and BP numbers Structure and Stem Energy Full Picture . Sequence name . Alignment OR sequence (without name). The usage of Alignment is strongly recommended. Alignment example: . ... ANMF CGCGGGGTAGAGCAGCCTGGTAGCTCGTCGGGCTCATA AQTRNF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAA BGTRF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAT ANMF ATCCTCTCCCCGCC---- AQTRNF ATCCGCCTCCCGGCACCA BGTRF ATCCGCCTCCCGGCACCA . ...

Еще в разделе: (Показать все результаты (>147) - www.genebee.msu.ru/ )

• vanyushin_dept
• GEA :: Gene Expression Analysis
• About EMBnet

... Vera S. Neudachina Department of Chemistry Moscow State University Leninskie Gory Moscow, Russia,119899 Tel: (095) 939-4665 FAX: (095) 939-0998 e-mail: vera@ru.ru neudachina@inorg.chem.msu.ru . ... International Conference for students and post-graduates “Lomonosov-2001”, MSU, Moscow, – diploma for a successful report made in the Inorganic chemistry section. ... Field of interest: semiconductors, X-ray photoelectron spectroscopy, surface studies, quantum chemical modeling of the solid state. ...

Еще в разделе: (Показать все результаты (>76) - www.inorg.chem.msu.ru/ )

• Inorganic Synthesis Laboratory - Supramolecular and Cluster Compounds
• Inorganic Supramolecular Assembl