Skins overlay regular templates to give different looks and feels to Foswiki screens. ... Foswiki uses skin templates as the basis of all the screens it uses to interact with users. ... To see how Foswiki looks when no skin is selected, view this topic with a non-existant skin . ... Most skins, even those that look radically different to the default, use this layering approach, by basing themselves on the default skin templates (those template files with no skin name e.g view.tmpl , edit.tmpl etc). ...

Еще в разделе: (Показать все результаты (>2045) - wiki.cs.msu.ru/ )

... Paradigm shifts by Kuhn: successive change of one model by another, rather than integration of different paradigms Progress of science: from single- to multi-model approach Some examples from natural science... · theory of light: from vibration of ether to wave-particle duality · laws of motion: from Newton's dynamics to SchrЖdinger 's and Heisenberg's formalism In social and environmental sciences appreciation of the multi-model ...

Еще в разделе: (Показать все результаты (>5) - oc.cs.msu.ru/ )

... The RADEN data bank produced at the Department of Chemistry of Moscow State University is designed as well to accumulate published information on radiative parameters of diatomic molecules, as to analyse it and recommend the more reliable values. ... electronic transition moments D ( R ); . ... dipole moments, . ... FACTUAL RECOMMENDED DATABASE contains now the ab initio and experimental electronic transition moments for more than 250 band systems which belong to more than 100 diatomic molecules. ...

Еще в разделе: (Показать все результаты (>81) - electr003.chem.msu.ru/ )

Nd:YAG .. ... E-mail: onov@mail.ru 1 Creation of laser-induced morphology features in a different ambient, particularly air and vacuum, by a 532 nm nanosecond Nd:YAG laser on crystalline silicon is reported. ... Nd:YAG 532 . ... Nd:YAG 10 , 10 . ... 10 10000. LIPSS), , . ... 1. : a - 2 (LIPSS) 530 (0,5 / , , 3000 ), b - 2 2 (3 / , , 10000 ), c - (1 / , , 10000 2 ) d ­ (0,7 / , , 3000 ). (. 1) 530 20 3000 0,5 /2, . ... V. Craciun, D. Craciun, Appl. Surf. Sci. ... Phys. 88 (2000) 1638. ...

Еще в разделе: (Показать все результаты (>152) - nuclphys.sinp.msu.ru/ )

You are here: Iono Group / SAMNET / Magnetometers database . More information about each magnetometer is available by clicking on the station link. ... IMAGE . Alta, Norway . ... Andenes, Norway . ... SAMNET . ... BGS station, but archived at 1s resolution by SAMNET . ... Hankasalmi, Finland . ... IMAGE station, but archived at 1s resolution by SAMNET . ... 1s resolution data is available from the SAMNET data archive . ... This list can be filtered to show just SAMNET magnetometers . ...

Еще в разделе: (Показать все результаты (>95) - www.kosmofizika.ru/ )

• Index of /spravka/Magnetometers Database.files

Базы данных и таблицы . Проект ?Динамика экономического и социального развития России в XIX ? ... проект поддержан РГНФ, ?10-01-12114в) . Электронный ресурс - база данных 'Социально-экономические и политические факторы стачечного движения в России (1895-1904 гг.) Проект РФФИ ? ... Электронный ресурс - база данных "Агитационные материалы общественных движений, организаций и политических партий на начальном этапе массового рабочего протеста в России (1895-1904 гг.) Проект РГНФ ? ...

Еще в разделе: (Показать все результаты (>167) - hist.msu.ru/ )

• Labour recruiting policy and the Nobel Association of Oil Producers. A Set of
• Discrimination and the Labor Market in the Oil Industry in Baku
• Moscow University

... Head of the Department of Emission-line Stars and Galaxies of SAI MSU . ... Structure and kinematics of galaxies . ... Strasburg Database . Hubble Telescope Archive . ... CFHT Archive . ... Chinese evolutionary synthesis Yunnan . Korean evolutionary synthesis Yonsei . Evolutionary synthesis database BaSTI . ... Electronic Journal "New Astronomy" . Electronic Astrophysical Journal . Electronic Astronomical Journal . ... Questions and comments send to Olga Sil'chenko olga@sai.msu.su ...

Еще в разделе: (Показать все результаты (>50) - sn.sai.msu.ru/ )

The Database of Close Binary Systems . ... Team . ... This web-based interactive database is being developed and maintained by a team at the Sternberg Astronomical Institute of the Moscow State University . The project is an on-line extension of our catalogue on "Highly Evolved Close Binary Stars" (volumes I, II) published by Gordon and Breach in 1996. As of November 2009, the database (both the software and the content) is in its development/testing phase. Sternberg Astronomical Institute ...

Еще в разделе: (Показать все результаты (>23) - uranus.sai.msu.ru/ )

• Stellar Astrophysics Department

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>18) - mouse.genebee.msu.ru/ )

• ConClus

... The University Information System RUSSIA (UIS RUSSIA) has been designed and is maintained as a corporate digital library for research and education in economics and social sciences. ... The RF State Statistical Agency publications are processed and arranged into databases «Regions of Russia», «Cities» and «Municipalities». The databases update indicators on 83 RF regions, 1071 cities and 25000+ municipal units. ...

Еще в разделе: (Показать все результаты (>150) - srcc.msu.ru/ )

• Laboratory of Informatics
• A.A.Goncharsky. High security holograms - covert and overt security features.
• M. V. Basilevsky, F. V. Grigoriev, O. Yu. Kupervasser. Specific features of the

... О UNИX . ... Adding a favicon to your wiki setup . ... Serving the wiki from wiki.domain.com and home page from www.domain.com . ... If you have mail configured for your MoinMoin wiki (see HelpOnConfiguration ) then users can have their password sent to the email address given in their user preferences (just click on Войти and read that page. ... There is no need for a ScriptAlias to moin.cgi, but you still need the alias to MoinMoin 's htdocs folder: Alias /moin_static160/ "/usr/share/moin/htdocs/"...

Еще в разделе: (Показать все результаты (>186) - uneex.mithril.cs.msu.su/ )

• HelpOnAutoAdmin - UNИX
• HelpOnParsers/ReStructuredText - UNИX
• HelpMiscellaneous/FrequentlyAskedQuestions - UNИX

INTERNET TECHNOLOGIES AND NEW CONCEPTION OF WDCs SYSTEM P.Yu.Pletchov, (Computer Center, RAS, Moscow, Russia, E-mail: lym@ccas.ru) Yu.S.Tyupkin (National Geophysical Committee of Russia Federation and Geophysical Center of RAS, Moscow, Russia, E-mail: tyupkin@wdcb.rssi.ru) In this technical report we wish to discuss the problem of setting up the distributed information system as a part of new conception of World Data Centers system. ... 4) Editing descriptions of an information resource by user. ...

Еще в разделе: (Показать все результаты (>483) - geo.web.ru/ )

• Mineralogy Database - Все о Геологии (geo.web.ru)
• Database of Raman spectroscopy, X-ray diffraction and chemistry of minerals -
• Geochemical Rock Database - Все о Геологии (geo.web.ru)

... 06-Mar-2012 17:50 . ... 17-Oct-2011 14:23 . 1.8K . ... 284 . ... 03-Dec-2010 15:29 . 25K . ...

Еще в разделе: (Показать все результаты (>2234) - swx.sinp.msu.ru/ )

• Index of /models/database/db/001126
• Index of /models/database/db/010402
• Index of /models/database/db/000912

Moscow State University Belozersky Institute of Physico-Chemical Biology . Department of Electron Microscopy is a sub-division of A.N. Belozersky Institute of Physico-Chemical Biology . ... We are interested of how eukaryotic cell is organized, formed and functioned. Since A.N. Belozersky Institute of Physico-Chemical Biology is one of the scientific departments of Moscow State University ? ... Understanding the metaphase chromosome architecture remains a basic challenge in cell biology. ...

Еще в разделе: (Показать все результаты (>3) - cellbiol.genebee.msu.ru/ )

. Выберите категорию обращения: Общие вопросы Отчеты Рейтинги Диссертационные советы Конкурсы Ввод данных Структура организаций Пользователи Проблемы с регистрацией\входом в систему . Тема обращения: . Описание проблемы: . Введите почтовый адрес: . Войти в систему . Регистрация . Главная . Поиск . Статистика . О проекте . Помощь . Издательство: Springer-Verlag . Местоположение издательства: Heidelberg, Germany . ї 2011-2015 НИИ механики МГУ . Лаборатория 404. Все права защищены. обратная связь . Создать

Еще в разделе: (Показать все результаты (>1779) - istina.msu.ru/ )

• Vorobjev G.V. - сотрудник | ИСТИНА - Интеллектуальная Система Тематического
• Shipkova I. - сотрудник | ИСТИНА - Интеллектуальная Система Тематического
• Hoffmann W. - сотрудник | ИСТИНА - Интеллектуальная Система Тематического

The Database of Close Binary Systems . ... Team . ... This web-based interactive database is being developed and maintained by a team at the Sternberg Astronomical Institute of the Moscow State University . The project is an on-line extension of our catalogue on "Highly Evolved Close Binary Stars" (volumes I, II) published by Gordon and Breach in 1996. As of September 2009, the database (both the software and the content) is in its development/testing phase. ...

Еще в разделе: (Показать все результаты (>3) - dionis.sai.msu.ru/ )

... The lists of flora of Kem-Ludy archipelago (Russian White Sea, near Arctic Circle) produced in years 1962 and 2001-2004 were investigated by different methods of data analysis. The full species list contains 284 species. 27 islands were studied, four new islands were appeared due to the tectonic events. ... Most important factors are island square and openness (accessibility for winds). ... Marine birds are most important biological factor for island flora maintenance. ...

Еще в разделе: (Показать все результаты (>317) - herba.msu.ru/ )

• North Dakota Ethnobotany Database
• Behaviour of white water-lily flowers in different photoperiods
• The variability of different Drosera

IEEE International Workshop on Intelligent Data Acquisition and Advanced Computing Systems: Technology and Applications 21-23 September 2009, Rende (Cosenza), Italy Web and Grid Services for Training in Earth Observation 1 Marian Neagul, Silviu Panica, Dana Petcu, Daniela Zaharie1, Dorian Gorgan 2 West University of Timisoara, Bd.V.Parvan ... CONCLU SIONS GiSHEO's platform promises to deliver real-time services for satellite data processing for training activities for Earth observation. ...

Еще в разделе: (Показать все результаты (>37) - angel.cs.msu.su/ )

• : Package ucar.multiarray
• NetCDF User's Guide for C

Norwegian Libraries: . ... ARLIS - Kunstbib: Norwegian Art History Bibliography. ... The Norwegian Museum of Architecture . ... Art Museums . ... Henie-Onstad Art Center - Hovikodden: Norway's first Museum of Fine Arts on Internet. The Astrup Fearnley Museum of Modern Art . ... National Museum of American Art . Dallas Museum of Art . ... Electra '96 Henie Onstad Art Center's Project for Electronic Media. ... WWW-Library: History of Art . ... News: rec.fine.arts . ... News: k12.ed.art . ...

Еще в разделе: (Показать все результаты (>11) - www.hist.msu.ru/ )

Cranial morphometry and taxonomy of argali, Ovis ammon (Artiodactyla, Bovidae), from former Soviet Union and Mongolia. ... Skulls of mature males from different populations of the former Soviet Union and Mongolia were studied. ... Interspecies structure of argali Ovis ammon (Artiodactyla, Bovidae)] // Zoologicheskii Zhurnal. ... A population genetic comparison of argali sheep (Ovis ammon) in Mongolia using the ND5 gene of mitochondrial DNA; implications for conservation // Molecular Ecology. ...

Еще в разделе: (Показать все результаты (>5612) - zmmu.msu.ru/ )

• Types Database