Professor Yurij Shokin, born 1943, has been many years with the Computer Center and the Institute of Theoretical and Applied Mechanics (during the directorship of Academician N N Yanenko ) in Novosibirsk's scientific campus Akademgorodok and was director of the computer centre of the Soviet Academy of Sciences, Siberian Division, in Krasnoyarsk. ... He is an affiliate member of IFIP WG 2.5 and a member of the Russian Academy of Sciences. ... Russian Academy of Sciences . Siberian Division . ...

Еще в разделе: (Показать все результаты (>3113) - crydee.sai.msu.ru/ )

• V.A.Baturin - Home Page at Sternberg Astronomy Institute, MSU
• ASACafedra
• Миронова Ирина. Mironova Irina Home page

Optimization of electrospray ionization conditions for more informative mass spectra in structural research of HS for applications in medicine Mikhail A. Kazachkov1, Ivan V. Dubinenkov1, Alexey S. Kononikhin2,3, Igor A. Popov2,3, Irina V. Perminova1, Eugene N. Nikolaev2,3. ... The signal intensity was calculated as a summary intensity of 6 peaks from mass spectra, which were reproduced for each solvent and had high enough intensity even at not optimal conditions. ...

Еще в разделе: (Показать все результаты (>220) - mgumus.chem.msu.ru/ )

• http://www.mgumus.chem.msu.ru/publication/2010/2010-grigoryev-transhumus.pdf
• http://www.mgumus.chem.msu.ru/publication/2010/2010-vladimirov-combination.pdf
• List of participants

... Moscow State University . Russian Academy of Sciences . ... December, 2015 (Moscow State University, Department of Physics) . ... June, 2013 (Moscow State University, Department of Chemistry) . ... August, 2012 (Moscow State University, Department of Physics) . ... June, 2012 (Moscow State University, Department of Chemistry) . ... June, 201 1 (Moscow State University, Department of Materials Science) . ... 2015 (Moscow State University) . ... 2012 (Moscow State University) . ...

Еще в разделе: (Показать все результаты (>60) - nanofluidics.phys.msu.ru/ )

• Tatiana V. Nizkaya
• Olga I. Vinogradova
• Maduar

... On the Institute . ... Laboratory-chair of modelling the natural references of time . ... A.P. Levich , "Motivations and problems in the studies of time". in: "Constructions of Time in Natural Science: On the Way to Understanding the Time Phenomenon''. ... A.P. Levich , "Time as variability of natural systems: methods of quantitative description of changes and creation of changes by substantial flows. in: "Constructions of Time in Natural Science: On the Way to Understanding the Time Phenomenon". ...

Еще в разделе: (Показать все результаты (>812) - chronos.msu.ru/ )

• Laboratory-Division Quantum Electrodynamics of Self-Organizing Systems and
• Status of the Institute
• The Institute for Time Nature Explorations

... M.V.Lomonosov Moscow State University . ... Alexander OBRAZTSOV (Faculty of Physics, M.V.Lomonosov Moscow State University) Comparative Study of Electron Fields Emission from Nano-Carbons . ... Galia KITAEVA (Faculty of Physics, M.V.Lomonosov Moscow State University) ?-k Spectroscopy of Crystals and Superlattices Based on Spontaneous and Induced Non-linear Optical Parametric Interactions. ... Sergei KULIK (Faculty of Physics, M.V.Lomonosov Moscow State University) Biphotons in Quantum Communication ...

Еще в разделе: (Показать все результаты (>589) - phys.msu.ru/ )

• Российско-сингапурский форум в МГУ
• Кафедра компьютерных методов физики
• Faculty Staff

Information letter Dear colleagues! Faculty of Basic Medicine, Lomonosov Moscow State University and State Research Center ґ Institute for Biomedical Problems, Russian Academy of Science would like to invite you to participate in the work of the VII Russian National School with International Participation on Muscle and Exercise Physiology ?New approaches to studying of classical problems?. ... Abstracts of reports will be published. ... The receipt of your abstract will be confirmed by e-mail. ...

Еще в разделе: (Показать все результаты (>9) - www.fbm.msu.ru/ )

... General Psychology . Psychophysiology . ... Social Psychology . ... Psychological Principles of Personality Correction . ... Historical Psychology of Personality . ... Psychophysiology of Functional States . ... Social Psychophysiology . ... Psychological Influences on a Person in Clinical Psychology . ... Non-Russian Social Psychology in 20 th Century . ... Social Psychology of Personality . ... Process of Investigation in Social Psychology . ... Qualitative Analysis in Social Psychology . ...

Еще в разделе: (Показать все результаты (>209) - www.psy.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>6) - mouse.genebee.msu.ru/ )

... Astronomy search engine . ... PhysicsWeb Home Page . ... Sternberg Astronomical Institute . ... Astro Space Center Home Page . ... Landau Institute for Theoretical Physics . ... Astronomy and Space Physics Dept of Kiev University . ... NATIONAL RADIO ASTRONOMY OBSERVATORY Home Page . University of Hawaii - Institute for Astronomy . ... Space Telescope Science Institute Home Page . ... Sky & Telescope: The Essential Magazine of Astronomy . ... Springer LINK - Physics Online Library . ... Home . ...

Еще в разделе: (Показать все результаты (>464) - astro.uni-altai.ru/ )

... Data . ... Solar energetic particles . ... Projects . ... Neutron flux variations (RU) . ... InterHelio-Zond . ... INTERHELIO-Zond PROJECT . ... INTERHELIO-Zond project is being developed within the framework of the Federal Space Program of the Russian Federation . It is aimed at the research of the Sun from close distances including inner heliosphere and solution of the problems of solar corona heating, acceleration of the solar wind, origin of the solar flares and coronal mass ejections. ...

Еще в разделе: (Показать все результаты (>71) - smdc.sinp.msu.ru/ )

• Space monitoring data center
• Coronas-I - Space monitoring data center
• Space Monitoring Data Center

... CLEANSOIL . ... Therefore, the system is applicable to the remediation of soil below buildings, roads, pipelines, railroads, etc, for both local and/or diffuse contamination, and even for preventive applications. to develop and to test an innovative, simple, easy to handle, applicable under existing infrastructures and cost-effective on-site and in-situ soil remediation method able to achieve a degree of soil remediation that allows its reutilisation for different purposes; . ... http://soil.msu.ru ...

Еще в разделе: (Показать все результаты (>38) - eco.soil.msu.ru/ )

• Norwegian-Russian cooperation in the border area
• Risks of heavy metal inputs to agricultural and forest ecosystems in russia and
• Polluting metals in Russian terrestrial ecosystems: chemistry, dynamics, and

Вы посетили: conf_engl.html . ... International Algebraic Conference dedicated to 70th birthday of professor A.V. Mikhalev, Russia, Moscow, November 2010 . ... International Algebraic Conference dedicated to the 100-year anniversary of professor A.G. Kurosh, Russia, Moscow, May 2008 . ... 2nd International Conferences on Matrix Methods and Operator Equations, Russia, Moscow, July 2007 . ... staff/guterman/conf_engl.html.txt Последние изменения: 13.02.2013 11:26 (внешнее изменение) | ...

Еще в разделе: (Показать все результаты (>25) - halgebra.math.msu.su/ )

• staff:guterman:conf_rus.html | Кафедра высшей алгебры

Moscow 2009 14th Lomonosov Conference Nonhydrogen-like Graviatom Radiation Michael L. Fil'chenkov Yuri P. Laptev2 1 1 Institute of Gravitation and Cosmology, Peoples' Friendship University of Russia, Moscow Physics Department, Moscow Bauman Technical University 2 1 Moscow 2009 14th Lomonosov Conference Bound quantum systems via electromagnetic interaction Ї atoms Ї molecules gravitational interaction strong interaction Ї hadrons Ї nuclei ? ... Particles: mesons, leptons. ...

Еще в разделе: (Показать все результаты (>326) - nuclphys.sinp.msu.ru/ )

• E.L.Fainberg (right) International Seminar on high-energy physics problems,
• A.M.Baldin
• SIXTEENTH LOMONOSOV CONFERENCE ON ELEMENTARY PARTICLE PHYSICS

Either several (at least two) Intel/AMD-based computers having identical or similar hardware configuration and running in the local network environment under the control of Windows NT 4.0, Windows 2000, Windows XP, Windows Server 2003, Windows Vista, Windows Server 2008, or Windows 7. ... The 32-bit NT-MPICH package (the part of MP-MPICH) must be installed, including MPI dynamic link libraries and cluster management service, on all computers to be used to run PC GAMESS/Firefly in parallel. ...

Еще в разделе: (Показать все результаты (>116) - classic.chem.msu.su/ )

• PC GAMESS/Firefly DOCUMENTATION - running in parallel under Windows using WMPI
• PC GAMESS/Firefly DOCUMENTATION - running in parallel using LAM/MPI
• PC GAMESS/Firefly DOCUMENTATION - running in parallel Linux/MPICH binaries

Theory as a Lighthouse in the Electrochemical Ocean . In memory of Alexander M. Kuznetsov . ... Until his last days he continued to work on various aspects of charge transfer phenomena. ... In electrochemical kinetics the theory always outruns the experiment, and the quantum mechanical theory of charge transfer created in the famous Theoretical Department of the Frumkin Institute in Moscow (R.R. Dogonadze, A.M. Kuznetsov and co-authors) is a good example for that. ...

Еще в разделе: (Показать все результаты (>102) - electr003.chem.msu.ru/ )

• Laboratory of Electrical Double Layer and Electrode Kinetics
• Theoretical Department of the Institute of Electrochemistry AN USSR

... One of the project objectives was to investigate practical efficiency of some modern iterative methods, including multigrid techniques and domain decomposition methods as well as methods for small compressible materials. ... Hence, the project research initiated because of INTAS financial support contributes in setting up modern computational techniques in tire design. ... Research on efficiency of iterative methods was conducted at the department of Mechanics of Composites about ten years ago. ...

Еще в разделе: (Показать все результаты (>4) - composite.msu.ru/ )

• Pobedria Boris Efimovich

Space Scientific and Education project of Lomonosov Moscow State University "MSU-250" is timed to its 250-th annversary. ... Scientific program is directed to the studies of the space physics problems. It includes development and launch of two supersmall satellites intended mainly to the studies of the radiation conditions in the near-Earth space. ... The conference "University Satellites and Space Science Education" (UNIVERSAT-2006) was held in Moscow on June 26-30, 2006. ...

Еще в разделе: (Показать все результаты (>6728) - cosmos.msu.ru/ )

• University Satellites and Space Science Education '2006

Network Working Group Poorer Richard Request for Comments: 1216 Almanac Institute Prof. Kynikos Miskatonic University 1 April 1991 Gigabit Network Economics and Paradigm Shifts Status of this Memo This memo proposes a new standard paradigm for the Internet Activities Board (IAB) standardization track. ... Efficiency is a problem: Richard & Kynikos [Page 3] RFC 1216 Gigabit Network Economics and Paradigm Shifts April 1991 - All ULS protocols incorporate slow-start. ...

Еще в разделе: (Показать все результаты (>14758) - mirror.msu.net/ )

• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/pdfrfc/rfc1216.txt.pdf
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc169.txt
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/pdfrfc/rfc155.txt.pdf

... My field of specialization is Stability Theory, Nonlinear Dynamics, Asymptotic Methods, Mechanics of Solids, System Identification, Optimal Control, Economic Growth. ... A.O. Belyakov and A.P. Seyranian (2012). ... A.O. Belyakov and A.P. Seyranian, . ... A.P. Seyranian and A.O. Belyakov, Swing dynamics. ... A.O. Belyakov, A.P. Seyranian, and A. Luongo, Regular and chaotic dynamics of the swing. 6th EUROMECH Nonlinear Dynamics Conference (ENOC 2008) , Saint Petersburg, Russia, June, 30 - July, 4 2008...

Еще в разделе: (Показать все результаты (>13) - belyakov.imec.msu.ru/ )

Summary Progress Report 2010 ґ 2014 UNESCO Chair on Global Problems and Emerging Social and Ethical Challenges for Large Cities and Their Population at the Faculty of Global Processes of the Lomonosov Moscow State University Period of activity: September 2010 June 2014 Title of the Chair : UNESCO Chair on Global Problems and Emerging Social and Ethical ... Visit of UNESCO Director-General Irina Bokova at Moscow State University September 9, 2011. ...

Еще в разделе: (Показать все результаты (>3070) - fgp.msu.ru/ )