On problem of interpretation and forecasting space-temporary variations of geophysical fields on results of deep scientific drilling Esipko O.A., Kolbasova A.V., Rosaev A.E. In the process of boring the deep bore holes, as scientific, so and industrial one's living, and when processing the received results, the problem of large arrays of data analyses appears. ... The example of geophysical data development As an example of with depth and variation log data with 0.2 meters of (verified) data. ...

Еще в разделе: (Показать все результаты (>60) - acat02.sinp.msu.ru/ )

• http://acat02.sinp.msu.ru/presentations/konash/Slides_ACAT2002.doc
• http://acat02.sinp.msu.ru/presentations/litinski/litinski.doc
• http://acat02.sinp.msu.ru/presentations/tyupikova/doclad.doc

... Andrey Lagarkov, Igor Budashov, Vladimir Chistyaev, Alexander Ezhov, Andrey Fedyanin, Andrey Ivanov, Ilya Kurochkin, Sergey Kosolobov, Alexander Latyshev, Dmitriy Nasimov, Ilya Ryzhikov, Maxim Shcherbakov, Aleksandr Vaskin, Andrey K. Sarychev . ... OPTICS EXPRESS . ... Ultrafast dynamics of third harmonic generation in fishnet metamaterials" . ... Nonlinear absorption in plasmonic metamaterials" . ... Static and dynamic properties of third harmonic generation in fishnet metamaterials" . ...

Еще в разделе: (Показать все результаты (>82) - nanolab.phys.msu.ru/ )

• Nanophotonics of surface states in photonic crystals | Laboratory of

... We studied the quantum properties of coupled parametric process consisted of four parametric downconversions, which can be produced at nonlinear wave interactions with quasi-phase-matching in aperiodically-poled nonlinear crystal. ... It is established that cluster entangled states are produced in the coupled parametric processes.The novel method of forming four-mode entangled states in one aperiodically-poled nonlinear crystal was studied in this work. ...

Еще в разделе: (Показать все результаты (>118) - ofvp.phys.msu.ru/ )

• http://ofvp.phys.msu.ru/en/science_education/diploma/annot/2015/Lipatov_Magnitskiy_en.pdf
• http://ofvp.phys.msu.ru/en/science_education/diploma/annot/2015/Ushakov_Bukin_en.pdf
• http://ofvp.phys.msu.ru/en/science_education/diploma/annot/2007/Zjabko_Parashuk_en.pdf

... Новости лаборатории . ... Romanova N.A., Fritz M.A., Tamm N.B., Troyanov S.I. Synthesis and X-ray structure of C 2 -C 84 (22)(CF 3 ) 6 , Mend. ... 2014) 24 , 78-79 DOI . ... Konarev D.V., Romanova N.A., Panin R.A., Goryunkov A.A., Troyanov S.I., Lyubovskaya R.N. Magnetic coupling and optical properties of the S 6 -dodecakis(trifluoromethyl)fullerene radical anions in the layered salt (PPN + )[C 60 (CF 3 ) 12 .- ... Copyright 2006-2012, Лаборатория термохимии, Московский государственный университет ....

Еще в разделе: (Показать все результаты (>33) - thermolab.chem.msu.ru/ )

... Laboratory of Medicinal Chemistry was established at the Department of Chemistry, Lomonosov Moscow State University in October 2013. ... We apply modern molecular modeling and chemoinformatics methods as well as develop new approaches. ... We have developed efficient methods for the analysis of quantitative structure-activity relationships and design of novel promising structures based on diverse theoretical approaches. ... Home . ... Research . ... 2016 Laboratory of Medicinal Chemistry ...

Еще в разделе: (Показать все результаты (>9) - qsar.chem.msu.ru/ )

Brain Research Group >> Research >> Change-point analysis ... << previous next >> . ... Application of the change-point analysis to the investigation of the brain's electrical activity. ... The EEG is also an effective tool for brain disease and traumatic lesion diagnostics. ... It is evident, however, that effective control of body functioning requires strict constraining of the number of degrees of freedom at all levels of the brain structural and functional hierarchy. ...

Еще в разделе: (Показать все результаты (>88) - brain.bio.msu.ru/ )

• Change-points in multi-channel EEG
• Change-points at different levels of the hierarchy of EEG segmental...

... education . research . ... Microstructure deeply influences the properties and thus the functionality of a material. In an X-ray diffraction pattern, the microstructure information is usually extracted from the breadth and shape of line profiles. ... Доклад ?Structure/microstructure and their interplay in nanomaterials and layered systems? оказался очень полезным и интересным для ученых, работающих в области неорганического синтеза и физико-химических методов исследования. ...

Еще в разделе: (Показать все результаты (>28) - nano.msu.ru/ )

• MSU Nanotechnology Education and Research Center. Mission. | MSU Nanotechnology

... Algorithm & . Format requirements . ... SDPsite is a tool for identification of protein active and other functional sites, based on spatial clustering of SDPs (specificity-determining positions, described here ) with CPs (conserved positions). ... Mapping predictied positions onto structure and construction of the best cluster . ... The input data of the algorithm are a multiple protein alignment divided into specificity groups . ... is called statistical significance of the set of k* positions . ...

Еще в разделе: (Показать все результаты (>140) - bioinf.fbb.msu.ru/ )

• RNA Kinetics: Result explanation
• RNA kinetics server
• SDPpred

Russian version . ... Leninskie Gory 1, Moscow, 119991, Russia . ... The title is: "The development of resonant X-ray reflectivity method near the L2,3 absorption edges for investigations of magnetic multilayers". ... Moscow. ... Russia. ... A. Smekhova, е.ю. Gan'shina, B.S. Roschin, A.D. Gribova, M.A. Andreeva, F. Wilhelm, A. Rogalev, "Structural and Magnetic Studies of [Co 0.45 Fe 0.45 Zr 0.1 /a-Si] N Multilayers", Journal of Spintronics and Magnetic Nanomaterials, 1 (1), pp.11-17 (2012) [pdf] . ...

Еще в разделе: (Показать все результаты (>909) - magn.phys.msu.ru/ )

• Information for 2nd year students
• Сотрудники кафедры магнетизма: Родионова Валекрия Викторовна
• Сотрудники кафедры магнетизма: Перов Николай Сергеевич

COMBINATORIAL FORMULAE FOR THE y -GENUS OF A MULTIORIENTED QUASITORIC MANIFOLD T. E. PANOV In [1] the authors introduced the class of smooth manifolds with a compact torus action whose orbit space carries combinatorial structure of a simple polytope. ... The following theorem from [3] shows that a multioriented quasitoric manifold can be invested with a canonical stably complex structure. Theorem 1. ... Let M 2n be a multioriented quasitoric manifold, and let be a vector described in Theorem 4. ...

Еще в разделе: (Показать все результаты (>263) - higeom.math.msu.su/ )

• http://higeom.math.msu.su/people/taras/papers/umn/umn-s99e.ps
• http://higeom.math.msu.su/bedlewo2009/Schedule.pdf
• http://higeom.math.msu.su/course_papers/lim4.pdf

Evgeny V. Antipov . ... Selected original papers . ... Synthesis, structure and superconducting/magnetic properties of Cu- and Mn-based oxyfluorides / E.V. Antipov and A.M. Abakumov// Functionalized Inorganic Fluorides (edited by Alain Tressaud), -2010. ... Advanced electron microscopy and its possibilities to solve complex structures: application to transition metal oxides / Gustaaf Van Tendeloo, Joke Hadermann, Artem M. Abakumov and Evgeny V. Antipov /// JOURNAL OF MATERIALS CHEMISTRY. ... 2008. ...

Еще в разделе: (Показать все результаты (>134) - electr003.chem.msu.ru/ )

• Veronika K. Laurinavichute: Selected Publications

Databases (NSDC) of the Natural Planetary Satellites. ... NSDC: Database of astrometric observations of Natural Planetary Satellites . ... They are thoroughly looking for observations in different sources, creating their owndatabases which are then mostly inaccessible to other researchers. ... In the file "content" with explications, the reference is given to the data source as well as the bibliographic reference. ... Data sources. ... Why a specific bibliographic database for Natural satellites? ...

Еще в разделе: (Показать все результаты (>809) - lnfm1.sai.msu.ru/ )

• Division of the Galaxy and Variable Stars

Home . Database of structures of nucleic acid - protein complexes . ... List of complexes . Pfam families . SCOP families . Interaction classes . ... NPIDB . ... Information on SCOP and Pfam domains detected in protein chains is presented. ... Each family has its own web page with the list of entries that include domains of the family. ... List of SCOP domains occurred in DNA-protein and RNA-protein complexes is organized in tree-like form, according to the SCOP classification. ...

Еще в разделе: (Показать все результаты (>8) - npidb.belozersky.msu.ru/ )

• NPIDB: Interaction classes
• NPIDB: Families of interaction class

Research Center for Environment and Health (GSF)#FE 75184, BA 31/139166/02/U, 2002-2004, PI: Perminova I.V. Humic substances as natural adaptogens: evaluation of the biological effects and their relationship to the molecular properties . ... to establish a linkage between the structure, molecular properties and adaptogenic activity of HS, and conclude on the most prospective source and treatment technique for obtaining the humic materials of the specific activity . ...

Еще в разделе: (Показать все результаты (>169) - mgumus.chem.msu.ru/ )

• MGUMUS -- Irina V. Perminova

... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . ... VS'08 properties editor ToolStripMenuItem . ... Re: VS'08 properties editor ToolStripMenuItem [ re: Yorik ] . ... Re: VS'08 properties editor ToolStripMenuItem [ re: Orient ] . ...

Еще в разделе: (Показать все результаты (>35683) - www.fds-net.ru/ )

• Как в Oracle использовать константы в select? - Public forum of MSU united
• Продолжение невозможно. - Public forum of MSU united student networks
• Как навести порчу? - Public forum of MSU united student networks

... The second half of the 20 th and the beginning of the 21 st century have witnessed an unprecedented increase in the rate of new mineral discoveries, as a result of which the overall mineral system has grown from 2000 to more than 4000 species in a relatively short time. ... Almost all of the new minerals from the Kola region were discovered in ore deposits related to three types of alkaline rock associations: agpaitic nepheline syenite massifs, carbonatite-bearing complexes, and alkaline granites. ...

Еще в разделе: (Показать все результаты (>6064) - geo.web.ru/ )

• http://geo.web.ru/conf/alkaline/2009/Grigorieva_et_al.htm
• http://geo.web.ru/conf/alkaline/2009/Depmeier.htm
• Сайт Number Theory Web - Все о Геологии (geo.web.ru)

Slippage on hierarchical superhydrophobic surfaces (theory, simulation) The exceptional wetting properties of superhydrophobic (SH) surfaces [1] have motivated numerous applications in microfluidics. ... Recent experiments have shown that a hierarchical surface with nanoposts lying on the top of microposts does not necessarily lead to an increase in the effective slip length [5]. ... The main goal is to determine, how the effective slip length depends on the number of hierarchy levels. ...

Еще в разделе: (Показать все результаты (>38) - nanofluidics.phys.msu.ru/ )

Title Author Review of the monograph of V.I . Dobren'kov and N.R. Ispravnikova Pyramids of missed opportunities (the Russian version of crony capitalism ) Verkhovin V.I . Russian privatization, the transition period in the economy , the legitimation of private property in Russia, an alliance of state power and elected oligarchic groups, crony capitalism , the network structure of Russian big ...

Еще в разделе: (Показать все результаты (>46) - www.socio.msu.ru/ )

... Alignment Sequence . Include picture . No Picture Only Structure Structure and BP numbers Structure and Stem Energy Full Picture . Sequence name . Alignment OR sequence (without name). The usage of Alignment is strongly recommended. Alignment example: . ... ANMF CGCGGGGTAGAGCAGCCTGGTAGCTCGTCGGGCTCATA AQTRNF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAA BGTRF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAT ANMF ATCCTCTCCCCGCC---- AQTRNF ATCCGCCTCCCGGCACCA BGTRF ATCCGCCTCCCGGCACCA . ...

Еще в разделе: (Показать все результаты (>229) - www.genebee.msu.ru/ )

• Databases
• Screening of pattern or alignment against PROTEIN databank
• Screening protein sequence against PROSITE databank

... Home News Colloquium on 04.06.10 . ... Natalia Golovina "Structure and propertiesљof mixed ammonium sulfates and nitrates" . Konstantin Tokarev " Physical-chemical properties of seleno-organic compounds with aliphaticљљsubstituents" . ... Colloquium on 24.12.12 20 Dec 2012 . ... Colloquium on 23.11.12 22 Nov 2012 . ... Lomonosov Moscow State University . Department of Chemistry . ... Laboratory of Chemical Thermodynamics . ... 2000-2016 Laboratory of Chemical Thermodynamics . ...

Еще в разделе: (Показать все результаты (>19) - td.chem.msu.ru/ )

• Colloquium on 19.10.12 Laboratory of Chemical Thermodynamics
• Publications Laboratory of Chemical Thermodynamics
• PhDi Laboratory of Chemical Thermodynamics