... Астронет | ... планета Астронет | ... Астрономия в России | ... История астрономии . ... Любительская астрономия . ... Кривая блеска GRB 030329 . ... Includes most data through GCN 2276 . Light curve of posted GCN observations of GRB030329, including AAVSO observations, by Melissa Nysewander (UNC-Chapel Hill) . ... Публикации с ключевыми словами: гамма-всплески - оптические ореолы гамма-всплесков . ... Самый далекий, самый желанный . GRB 090423: самый далекий взрыв . ...

Еще в разделе: (Показать все результаты (>15699) - www.astronet.ru/ )

• Journal "Peremennye Zvezdy"
• Astronet > Sky Map, professional edition
• Full Moondark

Y. A. Plyushkyavichyute yuratep@student.ethz.ch EVALUATION OF POSSIBLE CARTOGRAPHIC AND REMOTE SENSING METHODS FOR DETECTING TEMPORAL CHANGES IN THE URBAN AREA IN THE ALPINE REGION Swiss Federal Institute of Technology, Zurich ABSTRACT This project explores the potential of Cartographic and Remote Sensing approaches in the study of Alpine urban region in order to detect the temporal changes. ... Result 1: Cartographic approach, raster analysis. ... Result 3: Remote Sensing Approach, NDVI analysis. ...

Еще в разделе: (Показать все результаты (>224) - www.geogr.msu.ru/ )

• CONTENTS ? 6 - 2013
• CONTENTS ? 2 - 2014
• CONTENTS ? 4 - 2012

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>17) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

This module provides the ability to set environment variables based upon attributes of the request. ... The mod_setenvif module allows you to set environment variables according to whether different aspects of the request match regular expressions you specify. ... BrowserMatch . ... Syntax: BrowserMatch regex env-variable [= value ] [ env-variable [= value ]] .. ... Module: mod_setenvif . ... The BrowserMatch directive defines environment variables based on the User-Agent HTTP request header field. ...

Еще в разделе: (Показать все результаты (>84) - neptun.sai.msu.ru/ )

• Apache module mod_headers
• Definitions of terms used to describe Apache directives
• Manual Page: ab - Apache HTTP Server

... Methods for non-uniform illumination correction, blood vessel detection and macula and optic disc segmentation, finding dark and light spots in the macula area are suggested. ... CONCLUSION The proposed in the paper algorithms for non-uniform illumination correction, blood vessel detection, macula and optic disc segmentation in retinal images, finding light and dark spots in the macula area compose the basis of the telemedicine system of retinal image analysis developed by the authors group. ...

Еще в разделе: (Показать все результаты (>220) - imaging.cmc.msu.ru/ )

• http://imaging.cs.msu.ru/pub/2010.Graphicon.Sorokin_Krylov.QualityEst.en.pdf
• http://imaging.cs.msu.ru/pub/2012.CISP-BMEI.Chernomorets_Krylov.RetinalQ.en.pdf
• Image sharpening by grid warping | Laboratory of Mathematical Methods of Image

... О UNИX . ... MonthCalendar . ... Show Single Month . Entire Year Calendar . Markup . Result . Current Month Calendar . ... MonthCalendar(BasePage,year,month,monthoffset,monthoffset2,height6,anniversary,template)>> . ... Base page for calendar entry pages. year . ... Year to display on calendar. month . ... Year calendar (no year in page links). template . ... 2016 / 4 > >> . ... Calendar of year 2002 (every month padded to height of 6): . ... Year 2002 . ... see also: HelpOnMacros . ...

Еще в разделе: (Показать все результаты (>146) - uneex.mithril.cs.msu.su/ )

• HelpOnTables - UNИX
• HelpOnFormatting - UNИX
• LecturesVMSH/Python/2013-10-11/Results - UNИX

... Data . ... Models . ... Paraboloid model . ... SHIELDOSE is a model for space-shielding radiation dose calculations. ... Next the index of the detector type is specified, for example '1'. ... The next number indicates the nuclear interaction account, for example 1: . ... The next pair of numbers is about solar protons, the min and max energy of solar protons spectrum, default values are 0.1 and 10000 MeV. ... The next number is the number of spectrum points which divides spectrum for integration. ...

Еще в разделе: (Показать все результаты (>21) - smdc.sinp.msu.ru/ )

... The purpose of our research was to find significant differences in island and mainland plant populations of the Russian White Sea. ... New islands were inhabited from the mainland, and as a result the population on it becomes isolated from the mainland. ... As a result the island population becomes different from the mainland populations. ... On each plant we measured about 8–12 morphological characteristics, which are known to be the most variable; 59 morphological characteristics in all. ...

Еще в разделе: (Показать все результаты (>272) - herba.msu.ru/ )

ON THE ORIGIN OF THE KAIDUN CR2 CHONDRITE GLASSES Kashkarov L.L., Kalinina G.V., Skripnik A.Ya. ... In given work the results of structural, petrology-chemical and track researches of glass fragments of a meteorite Kaidun are presented: On the basis of the received data the possible processes of origin of these glasses at an early stage of formation of a meteorite parent body are considered. ... The glass samples were preferentially out of crushed Kaidun meteorite. ... Nuclear Tracks in Solids. ...

Еще в разделе: (Показать все результаты (>494) - geo.web.ru/ )

• http://geo.web.ru/conf/alkaline/2009/Volodkova.htm
• http://geo.web.ru/COMPASS/geoproc/index.html
• http://geo.web.ru/conf/alkaline/2009/Girnis.htm

... This program was created for correlating chosen regions in the series of fts images. ... Chosen regions' . ... In this section the program counts the integral for each region of the grid for each image. ... As a matter of fact, the integral is total brightness of the region and it is counted by 'int_tabulated' IDL function. ... In addition, the program will show the count of the regions which correlate with the corresponding region (the brighter region means the bigger count) and its contour. ...

Еще в разделе: (Показать все результаты (>226) - lnfm1.sai.msu.ru/ )

• Data bases of Natural Satellites. Documentation. Structure

... Data . ... Planetary perturbations during geomagnetic storms are measured by the Dst index, which is the deviation of variation of the magnetic field from the undisturbed level, averaged over the values measured at the control chain of magnetic stations located in the low latitudes. ... To predict the hourly values of the Dst index, artificial neural networks (ANN) of perceptron type are used. ... Loading of the data on the values of the Dst index and forecast update are performed twice per hour. ...

Еще в разделе: (Показать все результаты (>9) - swx.sinp.msu.ru/ )

... Paracoccus denitrificans proton-translocating ATPase: kinetics of oxidative phosphorylation. ... The initial rates of ATP synthesis catalyzed by tightly coupled Paracoccus denitrificans plasma membrane were measured. The reaction rate was hyperbolically dependent on the substrates, ADP and inorganic phosphate (P(i)). ... The substrate binding in the ATP synthesis reaction proceeds randomly: K(m) value for a given substrate was independent of the concentration of the other one. ...

Еще в разделе: (Показать все результаты (>90) - biochem.bio.msu.ru/ )

• [Diagnostic value of cardiac troponin T increase in critically ill patients].
• Measurement of B-type natriuretic peptide by two assays utilizing antibodies

Measurement of Sky Brightness at the Iranian National Observatory Davoud Afshari1 and Sadollah Nasiri1,2 1Physics Department, Zanjan University, Zanjan 45195-313, Iran; Institute for Advanced studies in Basic Science (IASBS), Zanjan 45195-1159, Iran; Measurement of light pollution 2 Introduction Among 34 candidate sites at the central part of the country, 5 sites namely Garkesh (in Kashan ), Kolahbarfi(in Kashan ), Deynava (in ... One of these is light pollution. ...

Еще в разделе: (Показать все результаты (>25) - site2010.sai.msu.ru/ )

• http://site2010.sai.msu.ru/static/doc/AGusev_site2010.pdf
• Results of ELT site testing programs - I
• Results of ELT site testing programs - II

... Phase of Shock Wave Harmonics in Focused and Unfocused   Ultrasonic Sound Beams . ... We present experimental results from   2 plane and 2 focusing sound sources with   frequencies near 1 MHz in water. ... For plane   sources: after small fluctuations within the   nearfield the phase parameter flattens out at a   value near -pi/2, reaching a slightly more   negative value with higher source amplitudes. ... They are more sensitive to the   source amplitude than with the plane sources. ...

Еще в разделе: (Показать все результаты (>217) - acs366.phys.msu.su/ )

• Abstract

DVM debugger - contents . Part 1 (1 - 4) . ... Writing to read-only variable is detected. ... Using non-initialized element <elem> . ... Using variable <var> before asynchronous reduction competed . ... The dynamic debugger detects access to a shadow element before asynchronous shadow renew competed . ... It is reported when any non-correspondence of trace or loop description file is detected. ... Different values of reduction operation are detected for current event and in reference trace record. ...

Еще в разделе: (Показать все результаты (>117) - sp.cs.msu.ru/ )

• Lib-DVM. Interface description
• DVM-system. Goals and structure
• Performance Analyzer. Detailed design

... Three representative parameters characterizing the solar activity are sunspot number (W), 10.7cm radio solar flux (F10.7) and mean solar magnetic field value (SF). ... Practically persistent time series of these parameters are appropriate data sets for modelling and forecasting by means of Artificial Neural Networks (ANN). Methods of optimization of ANN input data sets and selection of training, testing and examination sets are discussed in the paper. ...

Еще в разделе: (Показать все результаты (>10) - dbserv.sinp.msu.ru/ )

SELECT data_key, data_value FROM xf_data_registry WHERE data_key IN ('options', 'languages', 'contentTypes', 'codeEventListeners', 'cron', 'simpleCache', 'routesPublic', 'bannedIps', 'styles', 'nodeTypes', 'smilies', 'bbCode', 'displayStyles', 'trophyUserTitles', 'reportCounts', 'moderationCounts') . ... Select Type . ... Type . ... Params: 0, 1572084565, XenForo_ControllerPublic_Help, BbCodes, valid, , 1460234196 . ... library/XenForo/ Autoloader.php . ... library/XenForo/ Dependencies/Abstract.php . ...

Еще в разделе: (Показать все результаты (>26) - osk.msu.ru/ )

• http://osk.msu.ru/forum/members/aaplicagf.1452/?_debug=1
• http://osk.msu.ru/forum/members/adollekautoto.2142/?_debug=1
• http://osk.msu.ru/forum/members/arbimeorirm.2192/?_debug=1

... Кредитная система как модель оценки учебных программ в университетах и колледжах ЕС и Северной Америки, характеристика Европейской кредитной трансферной системы (ECTS) и ее реализация в 1995-1998 гг. Ключевые слова: Финансирование образования. МАТЕРИАЛЫ ОБЩЕГО ХАРАКТЕРА. СТАТЬИ . ... L., 2000. ... Ключевые слова: Наука в университетах. ... Ключевые слова: Рейтинги университетов. ... Материалы "круглого стола", организованного в Российском университете дружбы народов 12-13 марта 2001 года. ...

Еще в разделе: (Показать все результаты (>112) - srcc.msu.ru/ )

• A.V. Setukha. The singular integral equation method in a 3-d boundary problems
• Митрохин С. И. Spectral Properties of Boundary Value Problems for

... Please retype /font /b /td /tr % } tr td class = form nbsp; b Your name: /b /td td class =formi input type=text size= 60 value= %$ author % name= author /td /tr tr td class = form nbsp; b Your e-Mail: /b /td td class =formi input type=text size= 60 value= %$ dbh->quote($author) . ... br>"); return -1; } my $last_id=DB_functions::get_max_id($dbh,$tree,'id'); my $parent = ($id>0)?$id:0; if (!$dbh->do("INSERT INTO $tree (id,parent,resource) VALUES ( $last_id," . ...

Еще в разделе: (Показать все результаты (>81) - www.kosmofizika.ru/ )

• Нейтроны и космическая погода, Кужевский и др.

... In the light curve depicting their observations, definite trends are noted, here is a "thumb-nail" analysis of the the magnitude estimations of the bright SN (1989B) in the galaxy NGC 3627 (M66). ... 10 (IAUC # 4742) 2/25 13.3 16 j 2/27 13.5(*) 18 lc 2/28 13.8 19 p 3/1 13.2 20 w 3/2 13.5 21 a 3/4 13.8 23 p 3/6 13.3 25 c 3/7 13.3 26 c 3/8 14.1 27 m 3/8 13.3 27 r 3/9 13.4 28 c 3/9 14.1 28 m 3/10 13.6 29 j 3/10 14.0 29 a 3/11 13.6 30 c 3/11 13.5 30 r 3/11 13.7 30 s 3/13 [13.69 CCD Mag.] ...

Еще в разделе: (Показать все результаты (>151) - www.rochesterastronomy.org/ )