Главная Международные связи Иностранным студентам/ Incoming students . ... Semester Dates for International Students: . ... In case of institutional agreement on international student exchange the program is free of charge. ... All students should come to Russia by Moscow State University invitation. ... Students enter Russia with a single-entry visa. ... Exams/Passes . ... Pass . ...

Еще в разделе: (Показать все результаты (>36) - www.mgubs.ru/ )

... Students . ... Laboratory of Lithology and Facial Analysis . ... Laboratory of Marine Geology . ... The laboratory was organized as structural division of Faculty of Geology by the order of the Minister of Education of RSFSR in March, 1967. ... According to new structure of Faculty of Geology in 1976 the laboratory was included in structure of the Department of Dynamic Geology, and in 1983 was one of two laboratories including in structure of new Department of Lithology and Marine Geology. ...

Еще в разделе: (Показать все результаты (>70) - www.geol.msu.ru/ )

• Department of Lithology and Marine Geology - Generale Information
• Download Yuri Shvarov's files

MSSM Finite-Temperature Higgs Potential for Phase Transition Mikhail Dolgopolov (Samara State University) Dubinin M. (SINP MSU) Rykova E. (SSU) · · · · Introduction Finite-temperature corrections of squarks Thermal evolution and the critical temperature Conclusions Outline [ M. Dolgopolov, M. Dubinin, E. Rykova Threshold corrections to the MSSM finitetemperature Higgs potential. ... 1973 GeV Ilya F. Ginzburg, M. Krawczyk, Symmetries of two Higgs doublet model and CP violation. ...

Еще в разделе: (Показать все результаты (>178) - qfthep.sinp.msu.ru/ )

• http://qfthep.sinp.msu.ru/talks/Atlas_Prospects_2010_2011QFTHEP_Maleev_final1.pdf
• http://qfthep.sinp.msu.ru/talks/qfthep2010_dubinin.pdf
• http://qfthep.sinp.msu.ru/talks2013/Talk-NP1.pdf

... The aim of this project is the development of a new group of "smart" or intelligent materials, i.e. materials capable to follow small change of external conditions in a preset way. ... They represent a new type of composites consisting of small magnetic particles dispersed within a highly elastic polymeric matrix. ... Another straightforward application of the magnetic composites which will be implemented in the course of this project is based on their magnetic field dependent elastic modulus. ...

Еще в разделе: (Показать все результаты (>172) - polly.phys.msu.ru/ )

• Общие подходы к статистической термодинамике практически значимых сополимеров
• General Approaches to Statistical Thermodynamics of Copolymers of Practical
• NATO Scientific Environmental Affairs

... Length=2222430 Score = 55.4 bits (60), Expect = 6e-08 Identities = 53/68 (78%), Gaps = 0/68 (0%) Strand=Plus/Plus Query 141 TTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTC 200 || Sbjct 1090874 TTACTGGGCTTAAAGCGCCCGTAGCCGGCCCGGCAAGTCGCTCCTGAAATCCCCGGGCTC 1090933 Query 201 AACCTGGG 208 || ... Sbjct 2071246 AGCCGCGGTAATACGG 2071261 Score = 28.3 bits (30), Expect = 8.9 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Plus Query 222 ACTGGCAAGCTTGAG 236 || ...

Еще в разделе: (Показать все результаты (>27) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/blast_default.out
• ConClus

... Nor can the idea of intercultural communication be limited (as it was ? ... The department for discourse and communication studies in the School of Philology of Moscow Lomonosov University strives to provide for advanced level of verbal and visual (media) literacy, enabling students to combine critical and creative objectives, develop sophisticated analytical perspectives on the intersections of media, culture, translation, speech communication practices and social analysis. ... Mass culture ? ...

Еще в разделе: (Показать все результаты (>217) - www.philol.msu.ru/ )

• FDSL-7.5 | Practical Information

... List of solitary restriction endonucleases in complete prokaryotic genomes . List of groups of orthologous R-M systems. List of all analyzed genomes. Contains those orthologous groups that include at least one separated R-M system . R-M orthologous group ID . REs alignments . MTases alignment . Group 1 . ...

Еще в разделе: (Показать все результаты (>7041) - mouse.belozersky.msu.ru/ )

• PLANdbAffy: probe-level annotation database for Affymetrix expression
• NPG-explorer
• Geometrical core

Microsymposium 40, abstract 28, 2004 (A4 format) HIGH PURITY GE GAMMA-RAY SPECTROMETER ON JAPANESE LUNAR POLAR ORBITER SELENE. ... GRS consists of three parts; gamma-ray detector (GRD), compressor driver unit (CDU) and gammaray and particle electronics (GPE). ... It is retained at ~80K, by means of a mechanical cryostat. ... The asymmetric shape makes it efficient to veto gamma-rays from the SELENE vehicle and leakage photons from the Ge detector, as well as to avoid charged particles. ...

Еще в разделе: (Показать все результаты (>83) - selena.sai.msu.ru/ )

• Санович А.Н.
• Anatoly N. Sanovich
• Vladimir V. Busarev

Contemplating the evolution of Surface Nonlinear Optics seems to be highly instructive, able to stimulate one's own creativity and deeper understanding of current trends in this field. ... Hence, the Surface Nonlinear Optics Map, in its starting version, presents the names of researchers having made prominent scientific contributions to this branch of Optics. Related websites are accessible by clicking the corresponding names. ...

Еще в разделе: (Показать все результаты (>28) - shg.phys.msu.ru/ )

Russian Interdisciplinary . Temporology Seminar: . ... Journals about time . ... EVOLUTION. ... March 18, Tuesday . ... NEW TENDENCIES IN THE THEORY OF BIOLOGICAL EVOLUTION". ... SELF-ORGANIZATION AND PROGRESSIVE EVOLUTION IN NATURAL PROCESSES". ... EVOLUTION AND DEVELOPMENT OF BIOLOGICAL SYSTEMS AS MACROKINETICS OF RAMIFIED CHAIN PROCESSES". ... The laws guiding ramified chain processes in chemical and physical systems are similar to those which are characteristic of biological developement. ...

Еще в разделе: (Показать все результаты (>418) - chronos.msu.ru/ )

• A.P.Levich. What we expect from studying time
• Laboratory-chair of modelling the natural references of time

08-Dec-2006 08:17:57] PHP Warning: Invalid argument supplied for foreach() in / home / plogisti / public_html / modules / ax_visitors / atomax /edit_attr. php on line 289 [13-Dec-2006 05:12:41] PHP Parse error: syntax error, unexpected T_CONSTANT_ENCAPSED_STRING, expecting ']' in / home / plogisti / public_html / modules / ax_visitors / atomax /action_visitor. php on ...

Еще в разделе: (Показать все результаты (>5) - textbook.sinp.msu.ru/ )

You are here: Foswiki > System Web > ReferenceManual > DeveloperDocumentationCategory > PerlDoc (19 Apr 2011, ProjectContributor ) E dit A ttach . ... parsePatch($file ) -> %patch{filename} . ... updateFile($file, $patch, $reverse ) . ... Each patch file can patch one or more files. ... md5_of_target} = Will match the file version that can accept this patch. {patched} = Expected MD5 of the patched file. {version} = Comment from PATCH record describing the target. ... Patch target . ... Applies to . ...

Еще в разделе: (Показать все результаты (>2122) - wiki.cs.msu.ru/ )

... Line: 1 to 1 . Changed: . ... TWiki 4.2.3 is a patch release containing only the configure script as a security fix for TWiki:Codev.SecurityAlert-CVE-2008-3195 . ... TWiki 4.2.4 is a patch release which only contains over 30 bug fixes. This release also has a security fix for TWiki:Codev.SecurityAlert-CVE-2008-5304 and TWiki:Codev.SecurityAlert-CVE-2008-5305 . ... This release was targeted to fix the configure script as described security issue in TWiki:Codev.SecurityAlert-CVE-2008-3195 . ...

Еще в разделе: (Показать все результаты (>36395) - dualopt1.cmm.msu.ru/ )

• %TOPICTITLE% (2 vs. 3) - TWiki
• TWikiStoreRcsLiteDotPm - TWiki - TWiki
• TWikiStoreRcsLiteDotPm - TWiki - TWiki - (printable)

... I will touch upon the following points: ­ fast evolution of the sizes of quiescent (elliptical) galaxies between z = 2 and z = 1; ­ prolonged star formation histories of dwarf spheroidal galaxies in the Local Group; ­ apparent lack of external sources of cold gas accretion for the nearby spiral galaxies; ­ old stellar ages and magnesium overabundance of the large-scale disks of nearby lenticular galaxies. ... This discovery has challenged the recognized scenarios of elliptical galaxy evolution. ...

Еще в разделе: (Показать все результаты (>48) - sn.sai.msu.ru/ )

• http://sn.sai.msu.ru/~sil/preprints/iau254sil.pdf
• http://sn.sai.msu.ru/~sil/preprints/mnkatkov.pdf
• http://sn.sai.msu.ru/~sil/preprints/leo3.pdf

Conference . ... 3rd Announcement . 2nd Announcement . ... The 2006 autumn IVOA Interoperability Meeting and Small Project Meeting will be held in Moscow, Russia, from September 18-22. The venue for the meeting are Institute of Astronomy, Sternberg Astronomical Institute and Headquarter of the Russian Academy of Sciences. ... Working Groups: VOTable, UCDs, Registry, Data Models, Data Access Layer, VO Query Language, Grid and Web Services, and VOEvent. Interest Groups: Applications, Theory. ...

Еще в разделе: (Показать все результаты (>2) - www.agora.guru.ru/ )

... Study of amino- and pyridyl-containing zinc(II) and cadmium(II) complexes by molecular mechanics using a force field based on the Gillespie-Kepert model . ... Abstract - A new approach combining the molecular mechanics (MM) method and the Gillespie- Kepert model was applied to calculate the geometry and strain energy of zinc(II) and cadmium(II) complexes with amino- and pyridyl-containing ligands. ...

Еще в разделе: (Показать все результаты (>33) - analyt.chem.msu.ru/ )

• Conformational Analysis of Boron-Containing Compounds Using Gillespie-Kepert

Molecular phylogeny of the genus Alticola (Cricetidae, Rodentia) as inferred from the sequence of the cytochrome b gene Blackwell Publishing Ltd V LADIMIR S. L EBEDEV, A NNA A. B ANNIKOVA, A LEXEY S. T ESAKOV N ATALIA I. A BRAMSON Submitted: 29 January 2007 Accepted: 5 August 2007 doi:10.1111/j.1463-6409. 2007 .00300.x Lebedev, V. S., Bannikova, A. A., Tesakov, A. S. Abramson, N. I. ( 2007 ) Molecular phylogeny of the genus ... Molecular phylogeny of the genus Alticola Fig. ...

Еще в разделе: (Показать все результаты (>84) - vertebrata.bio.msu.ru/ )

• http://vertebrata.bio.msu.ru/Shedlock_Okada_2000_BE.pdf
• http://vertebrata.bio.msu.ru/mamm.70.1-2.106.pdf
• http://vertebrata.bio.msu.ru/RJG595_2006Eng.pdf

... Geography of World Economy . ... Cryolithology and Glaciology . ... Departments . ... Research laboratories . ... Field stations . ... Type of field courses . ... Department of Cryolithology and Glaciology The Department was founded in 1945 with the name Department of northern countries . ... Our students are active members of PYRN (Permafrost Young Researchers Network), in which they share best practices, information about conferences, field courses, jobs. ... ISBN 5-89176-095-9 . ...

Еще в разделе: (Показать все результаты (>110) - eng.geogr.msu.ru/ )

• ICCE events
• Research laboratory of recent sediments and pleistocene paleogeography
• Department of Landscape Geochemistry and Soil Geography

О лаборатории . ... Лаборатория теоретической биофизики . ... Here orig1 is the starting value of internal coordinate and zero corresponds to this value in current geometry. disp1 means step of scanning (degrees for angles and Angstroms for bonds). ndisp1 points number of steps in PES scan. vect1 ? ... Нет комментариев " Scanning PES ab initio and in MM " . ... OPLS-AA patch for different types of molecules . ... Scanning PES ab initio and in MM . ... 2015 ERG Research Group . ...

Еще в разделе: (Показать все результаты (>41) - erg.biophys.msu.ru/ )

• Using Firefly/GAMESS-US efficiently ERG Research Group: Лаборатория
• gromacs ERG Research Group: Лаборатория теоретической биофизики
• pymol ERG Research Group: Лаборатория теоретической биофизики

Diploma thesis abstract Generation and interaction of light beams containing polarization singularities in isotropic media with spatial dispersion of nonlinear optical response Kirill S. Grigoriev Supervisor: Vladimir A. Makarov The sub ject of the presented work refers to two branches of optical physics: nonlinear and singular. ...

Еще в разделе: (Показать все результаты (>104) - ofvp.phys.msu.ru/ )

• Публикация
• Laboratory of solid-state lasers and coherent spectroscopy