Выберите категорию обращения: Общие вопросы Отчеты Рейтинги Диссертационные советы Конкурсы Ввод данных Структура организаций Пользователи Проблемы с регистрацией\входом в систему . ... Richards K. , Bolikhovskaya N.S. , Hoogendoorn R.M. , Kroonenberg S.B. , Leroy S.A.G , Athersuch J. в журнале Holocene , издательство SAGE Publications (United States) , том 24, ? ... Авторы: Kasatenkova M.S. , Kasimov N.S. , Lychagin M.Yu , Kroonenberg S.B. Caspian Sea Workshop , Belgium, Бельгия, 2007 . ...

Еще в разделе: (Показать все результаты (>1670) - istina.msu.ru/ )

• Wu J. - сотрудник | ИСТИНА - Интеллектуальная Система Тематического
• Spiridonova O.I. - сотрудник | ИСТИНА - Интеллектуальная Система Тематического
• Nusinov A.A. - сотрудник | ИСТИНА - Интеллектуальная Система Тематического

... Alternative core new atoms (%) . ... An alignment of a set of structures is a set of positions , to each position some atoms from different structures correspond. ... Geometrical core of a set of structures is a subset of alignment positions those atoms are disposed similarly in all structures. ... For any two positions included into geometrical core, the distances between CA atoms of those positions in all structures may differ not more than the value of the parameter "Distance spreading". ...

Еще в разделе: (Показать все результаты (>6953) - mouse.belozersky.msu.ru/ )

• Alignment example
• Example of alignment

. SDPpred: a tool for prediction of amino acid residues . that determine differences in functional specificity of homologous proteins .

Еще в разделе: (Показать все результаты (>79) - monkey.belozersky.msu.ru/ )

• SDPpred
• ETS numeration assumed
• Example of supporting positions

Lasiopodomys brandti . Parental care in captive Brandt vole ( Lasiopodomys brandti Radde, 1861) . ... Prairie-vole partnership // American Scientist. ... Behaviour of Brandt vole (Lasiopodomys brandti Radde, 1852) in captivity. ... Territorial structure and social organization in Brandt vole (Lasiopodomys brandti) under semi-natural conditions] // Zoologicheskii Zhurnal. ... Parental care in the captive mandarin vole, Lasiopodomys mandarinus // Canadian Journal of Zoology Vol.8. ...

Еще в разделе: (Показать все результаты (>899) - zmmu.msu.ru/ )

• Uropatagium venation pattern in bats as diagnostic character (by the example of
• Russian Journal of Theriology

... Scientific conference . ... International recognition of this outstanding woman and scientist serves as a wonderful example for the young people who have chosen chemistry as the basis for the carrier, and makes it possible to commemorate the important contribution of women in the development of chemistry as a science.  ... Especially in Russia women received possibility of professional realization in chemical science and education through  different ways starting from 1870’s on. ...

Еще в разделе: (Показать все результаты (>149) - www.chem.msu.ru/ )

... HelpOnMacros/MailTo . ... Using the MailTo -Macro helps you putting your email address into a wiki in a rather safe way without having to fear that it gets collected by spam bots (robots collecting email addresses) and abused by some spammer. MailTo(Firstname DOT Lastname AT example DOT net)>> . ... MailTo(Firstname DOT Lastname AT example DOT net, link text)>> . ... Firstname DOT Lastname AT example DOT net . ... DOT . ... MailTo(Firstname DOT Lastname AT example DOT net, "Me, Myself, and I")>> . ...

Еще в разделе: (Показать все результаты (>225) - uneex.mithril.cs.msu.su/ )

• PspoMaterials/GnumericDoc_ru - UNИX
• HelpOnMacros/Include - UNИX
• LecturesCMC/PythonIntro2014/06_FilesModulesSystem/Examples - UNИX

Europrobe Moscow Workshop, October 29, 2001, Vernadsky museum . DSCN2329.JPG . DSCN2331.JPG . DSCN2332.JPG . ...

Еще в разделе: (Показать все результаты (>14) - sbmg.geol.msu.ru/ )

• INTAS team Workshop, October 28, 2001, Moscow university
• Tomography Resolution: review
• Photoalbums

October 3 . IMG_7129.JPG . IMG_7134.JPG . IMG_7136.JPG . IMG_7140.JPG . IMG_7150.JPG . IMG_7151.JPG . IMG_7153.JPG . IMG_7158.JPG . IMG_7160.JPG . ...

Еще в разделе: (Показать все результаты (>162) - mgumus.chem.msu.ru/ )

• October 1
• October 2
• October 4

... Recent research of the Laboratory of Photochemistry is concerned mainly with the problems of mechanisms and kinetics of several kinds of photoreactions in homogeneous media and in organized molecular systems. ... Electron Transfer Mechanism Exciplexes . Chain ion-radical reactions of photosubstitution in aromatic compounds . ... Electron transfer mechanisms of exciplex and excimer formation reactions kinetics were studied by fluorescence spectroscopy and flourescence kinetics methods. ...

Еще в разделе: (Показать все результаты (>497) - chem.msu.ru/ )

• Abstract Submission. III International Conference on Heterocyclic Chemistry, in
• Moscow University Chemistry Bulletin Vol. 55, No. 5, P. 267 (2014)
• Contacts. III International Conference on Heterocyclic Chemistry, in Honor of

Dear ECA alumni, . IREX is pleased to announce the October round of 2004 Alumni Small Grants Competition. ... The ECA Alumni Small Grants Program was piloted by IREX in February 1999. ... The purpose of the ECA Alumni Small Grants Program is to further the professional development of ECA alumni. ... We encourage you to contact your local IREX office with any questions and to check whether they will be holding an informational workshop for the ECA Alumni Small Grants Program in the near future. ...

Еще в разделе: (Показать все результаты (>137) - www.prof.msu.ru/ )

• Olympism and the Fulbright Spirit: Humanism in Action
• Effective University Management:Best Practices, New Trends and Strategies
• Conflict Transformation, Ngo And Networking

... Study how animals exploit or are constrained by their environment (requires simultaneous environmental observations) Tracking animals « above water » Page 3 Satellite tracking ( ARGOS ) of animals is always a challenge : Beacons with weak output power in difficult environmental conditions Majority of low accuracy positions (class A or B) with no error estimation Tracking animals underwater Page 4 Internal ...

Еще в разделе: (Показать все результаты (>2968) - www.sevin.ru/ )

• Экологический Форум - Фундаментальная Экология: to October factors life.
• Экологический Форум - Фундаментальная Экология: of also of rare, For October
• Povolzhskiy Journal of Ecology: Povolzhskiy Journal of Ecology: 2003, Issue 2

Moscow State University Faculty of Philology, Faculty of Fine and Performing Arts and Faculty of Psychology Free verse and Free Dance : Embodied Sense in Motion International Conference, 1-3 October 2010 Programme Update October 1, Friday Faculty of Arts 3/1 Bolshaya Nikitskaya st. Metro stations Biblioteka imeni Lenina , Borovitskaya . map: http://www Chair - Aleksandr Lobodanov . ... Movement, poetry and Dionysian Modernism in Britain: Irene Mawer's experiments with "dance words". ...

Еще в разделе: (Показать все результаты (>287) - www.philol.msu.ru/ )

• LangueDOC :: Archi :: Alphabet

MOSCOW STATE UNIVERSITY FACULTY OF ARTS FACULTY OF PHILOLOGY FACULTY OF PSYCHOLOGY International Conference FREE VERSE AND FREE DANCE : EMBODIED SENSE IN MOTION PR OGRAMME 1-3 October 2010 October 1, Friday Faculty of Arts 3/1 Bolshaya Nikitskaya st. Metro stations Biblioteka imeni Lenina , Borovitska ya , Okhotnyi Riad ... Movement, poetry and Dio nysian Modernism in Britain: Irene Mawer's experiments with "dance words". ... Heptachor, the Centre for Music and Movement (Moscow). ...

Еще в разделе: (Показать все результаты (>154) - www.psy.msu.ru/ )

DESCRIPTION OF THE 1d SOLAR EVENT MAP . ... In the case of 1d Map this is 1 day interval around the moment of the solar wind stream start from the Sun. ... This date coincides with central day of the map marked by solid vertical line (in the present example - 8 June, 2000). ... The following phenomena are presented on the map: coronal holes, filaments, solar flares and the distribution of the solar magnetic field on the source surface (2.5 solar radii). ... The filaments are indicated by blue spots. ...

Еще в разделе: (Показать все результаты (>10) - dbserv.sinp.msu.ru/ )

• Catalogue of Space Storms
• 3d Map Description

.

Еще в разделе: (Показать все результаты (>19) - www.chemport.ru/ )

• Real estate market monitoring october 2010 "медицинское имущество гражданской

The Caspian Region: Environmental Consequences of the Climate Change October 14-16, 2010. ...

Еще в разделе: (Показать все результаты (>254) - www.geogr.msu.ru/ )

• http://www.geogr.msu.ru/science/conf/university/Kasp_2010_engl.pdf
• Instructions for Authors, contributing to “GEOGRAPHY, ENVIRONMENT,
• Spatial resolution of ASTER, ETM+ and MSU-E

... Chemical Enzymology Department, Chemical Faculty . The M.V. Lomonosov Moscow State University, Lenin's Hills, 1/11 Moscow 119991, Russia . ... 7 (495) 939-31-70, Fax: +7 (495) 939-31-70, +7 (495) 939-54-17 . ... Ph.D. student, Moscow State University of Food Production, Biotechnology Faculty, Moscow, Russia, 2003 - 2006 . Master's Degree, Moscow State University of Food Production, Biotechnology Faculty, Moscow, Russia, 2003 . ... Number of Patents and Patent Proposals: 3 . ...

Еще в разделе: (Показать все результаты (>140) - www.enzyme.chem.msu.ru/ )

• Stepanov N.A.
• Lab of phys.-chim. basics of energy bioconversion

... Alignment Sequence . Include picture . No Picture Only Structure Structure and BP numbers Structure and Stem Energy Full Picture . Sequence name . Alignment OR sequence (without name). The usage of Alignment is strongly recommended. Alignment example: . ... ANMF CGCGGGGTAGAGCAGCCTGGTAGCTCGTCGGGCTCATA AQTRNF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAA BGTRF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAT ANMF ATCCTCTCCCCGCC---- AQTRNF ATCCGCCTCCCGGCACCA BGTRF ATCCGCCTCCCGGCACCA . ...

Еще в разделе: (Показать все результаты (>202) - www.genebee.msu.ru/ )

• Screening pattern or alignmemt against PROTEIN databank
• Screening by similarity
• screening by keywords

... Nonlinear Effects in Ultrasonic Transmission in Atomic Force Microscope Contacts . ... In Atomic Force Microscopy (AFM), the forces between a sharp tip and a surface of a sample determine the contrast observed in imaging. ... The eigenfrequencies of these modes depend on the forces acting between the tip and the sample surface. In case of a contacting tip a situation can be achieved where the Hertzian contact stiffness is prevailing. ...

Еще в разделе: (Показать все результаты (>197) - acs366.phys.msu.su/ )

• Abstract

COPRATES CHASMA NORTH WALL INTERIOR LAYERED DEPOSIT: LAYER MEASUREMENTS AND COMPARISON WITH JUVENTAE CHASMA ILDS USING MARS EXPRESS HIGH RESOLUTION STEREO CAMERA (HRSC) DERIVED TOPOGRAPHY Michael, G.1, E. Hauber1, K. Gwinner1, R. Stesky2 ... Planets, Freie Universitaet, Berlin, Germany 5ESTEC, ESA, Noordwijk, The Netherlands Introduction: The interior layered deposit ( ILD ) in the north wall of Coprates ... The lesser section of the ILD is confined by a ridge of the chasma wall. ...

Еще в разделе: (Показать все результаты (>108) - selena.sai.msu.ru/ )

• Шевченко Владислав Владимирович
• Anatoly N. Sanovich
• Родионова Жанна Федоровна