Status of mTCA Slow Control development at CMS Petr Volkov Lomonosov Moscow State University Skobeltsyn Institute of Nuclear Physics, Russia 6/27/2015 P. Volkov SINP MSU 1 uTCA: Introduction MicroTCA® - open standard for fabric computer systems. MicroTCA systems are both physically small and non-expensive. ... Use PVSSII and the JCOP Framework to develop your control applications. These are the official CMS DCS developing tools. ... CMS_MTCA_HCALTR_CRATE1 CRATES.. ...

Еще в разделе: (Показать все результаты (>154) - qfthep.sinp.msu.ru/ )

• http://qfthep.sinp.msu.ru/talks2015/QFTHEP15_Vorotnikov_v9.pdf
• http://qfthep.sinp.msu.ru/talks/pr_Gamzova.pdf
• http://qfthep.sinp.msu.ru/talks/Atlas_Prospects_2010_2011QFTHEP_Maleev_final1.pdf

... Форумы > Аспирантура > Тема . ... Аспирантура в Порту, Португалия . ... Grant call on E-Careers site: . ... Research Grant . ... Position/ Grant: PhD Research Grant. Generic scientific area: Engineering. ... Location: University of Porto, Faculty of Engineering, Department of Informatics Engineering (FEUP-DEI), http://www.fe.up.pt . ... This PhD research grant requires the completion of a PhD at the Department of Informatics Engineering, Faculty of Engineering, University of Porto (FEUP-DEI). ...

Еще в разделе: (Показать все результаты (>146) - www.mmonline.ru/ )

• MMOnline | Форумы | Аспирантура | Позиция постдока в Университете Бергена,
• MMOnline | Форумы | Аспирантура | Аспирантура в Барселоне, 15тыс евро в год,
• MMOnline | Форумы | Аспирантура | Research assistant in a world leading

... 2012 Flow and Ridge phenomena from the CMS. ... 2012 "Эллиптический поток" для студентов. 2012 г. ( Семинар ЛАВ ОЭФВЭ, весенний семетр 2012 г) . 2012 "Подавление частиц и 'погашение' струй " для студентов. 2012 г. ( Семинар ЛАВ ОЭФВЭ, весенний семетр 2012 г) . 2012 Краткий обзор доклада Heinz et al., 2012 г. ( Семинар ЛАВ ОЭФВЭ, 2012 г) . ... Е.Kondratuyk, V.L. Korotkikh, I.P. Lokhtin, S.V.Petrushanko ( Семинар ЛАВ ОЭФВЭ, 29 ноября 2012 г) . ... V.L. Korotkikh ( Семинар ЛАВ ОЭФВЭ, 2014 г) . ...

Еще в разделе: (Показать все результаты (>56) - lav01.sinp.msu.ru/ )

. О лаборатории . Welcome to WordPress. This is your first post. Edit or delete it, then start blogging! . This entry was posted on Saturday, June 12th, 2010 at 12:17 am and is filed under Uncategorized . You can follow any responses to this entry through the RSS 2.0 feed. You can leave a response , or trackback from your own site. Click here to cancel reply. You must be logged in to post a comment. Лаборатория лазерной интерферометрии is proudly powered by WordPress . Entries (RSS) and Comments (RSS) .

Еще в разделе: (Показать все результаты (>46) - geo.sai.msu.ru/ )

• Northern Lights over Norway Лаборатория лазерной интерферометрии
• О лаборатории Лаборатория лазерной интерферометрии
• GAMIT Лаборатория лазерной интерферометрии

... Opening of the educational programme - School of CEOs, "Capsule of security" for the key managers of Bashneft Group. ... April 11, 2013 - Bashneft Group in conjunction with JSFC "Sistema" opened the programme for the development of key Bashneft Group management - School of CEOs, "Capsule of security". ... At the end of his Welcoming Speech President of Bashneft Group stressed that this programme ? ... The School of CEOs ? ... 2006-2016 MSU Higher School of Management and Innovation. ...

Еще в разделе: (Показать все результаты (>9) - hsmi.msu.ru/ )

... 2, 1998 UNEXPECTED RECYCLIZATION OF PYRIDINIUM SALTS TO GIVE OXAZOLES E. V. Babaev and A. A. Tsisevich N-(Acylalkyl)-2-halopyridinium salts (I) are commonly used in the synthesis of azolopyridines with a bridging nitrogen atom. In particular, the formation of imidazo[l,2-a]pyridines and their N-alkyi- and N-aryl derivatives in the reaction of salts I with ammonia and primary amines [1, 2] or aromatic amines [1] is well known. ... Reactions of salts I with secondary amines have not been reported. ...

Еще в разделе: (Показать все результаты (>150) - www.chem.msu.ru/ )

• http://www.chem.msu.ru/eng/misc/babaev/papers/040e.pdf
• http://www.chem.msu.ru/eng/misc/babaev/papers/037e.pdf
• http://www.chem.msu.ru/eng/misc/babaev/papers/030e.pdf

... Length=2222430 Score = 55.4 bits (60), Expect = 6e-08 Identities = 53/68 (78%), Gaps = 0/68 (0%) Strand=Plus/Plus Query 141 TTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTC 200 || Sbjct 1090874 TTACTGGGCTTAAAGCGCCCGTAGCCGGCCCGGCAAGTCGCTCCTGAAATCCCCGGGCTC 1090933 Query 201 AACCTGGG 208 || ... Sbjct 2071246 AGCCGCGGTAATACGG 2071261 Score = 28.3 bits (30), Expect = 8.9 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Plus Query 222 ACTGGCAAGCTTGAG 236 || ...

Еще в разделе: (Показать все результаты (>28) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast.out
• ConClus

The Department of Talented Youth Affairs and Professional Orientation . ... News . ... Older posts . Newer posts . Posted on 16.02.2016 by editor . ... Posted in News | ... Olympiad has published the schedule of the final round: http://olymp.msu.ru/mod/page/view.php?id=1666 The final round of the Olympiad will be held in Moscow and regional sites in accordance with consistent schedule and tasks. ... 2016 - The Department of Talented Youth Affairs and Professional Orientation ...

Еще в разделе: (Показать все результаты (>168) - talant.msu.ru/ )

• News | The Department of Talented Youth Affairs and Professional Orientation |
• The contest for the design creation of ?Space University? logotype and emblem |
• admin | The Department of Talented Youth Affairs and Professional Orientation |

... x264 is an open source codec of standard MPEG4 AVC/H.264, developed by programmers from all over the world. ... Accumulated during previous frames' compressions statistic is actively used by codec to improve effectiveness of adaptive models. ... These parameters are used only before encoding start, so, our improvements are more significant for short sequences. ... 3 Results of codec x264 modification on "flower" sequence . ... 5 Results of codec x264 modification on "flower" sequence, low bitrates ....

Еще в разделе: (Показать все результаты (>243) - graphics.cs.msu.ru/ )

• x264 codec improvement | Лаборатория компьютерной графики и мультимедиа
• Video Matting Benchmark | Graphics and Media Lab Equation Equation Equation
• Automatic segmentation of mouse behavior using hidden Markov models | Graphics

Analysis of the ANTARES data for SN neutrino detection V. Kulikovskiy (MSU / INFN Genova) Hit counts in the detector. The number of hits ( hit counts ) in a time slice (104.8 ms) is used (this information is stored in each run) Mean number of hit counts in one PMT is ~5500 (corresponds to ~55 kHz) Expected number of hits from SN in 100ms is 11.6 ( 550 0) Bioluminescence bursts should be excluded Bioluminescence cut We have collected distributions of hit counts for each ...

Еще в разделе: (Показать все результаты (>16) - antares.sinp.msu.ru/ )

• http://antares.sinp.msu.ru/docs/MAM%202011%20-%20Katya.pdf
• http://antares.sinp.msu.ru/docs/INFN%20-%20Paper%201.pdf

... SDPfox - the software package for the prediction of functional specificity groups and amino acid residues that determine the specificity using MPA. ... Amino acid residues that determine differences in protein functional specificity and account for correct recognition of interaction partners, are usually thought to correspond to those positions of a protein multiple alignment, where the distribution of amino acids is closely associated with grouping of proteins by specificity. ...

Еще в разделе: (Показать все результаты (>144) - bioinf.fbb.msu.ru/ )

• SDPsite - Algorithm Format requirements
• User's guide
• Input Formats

... SUPER RATIO . ... On this page I will present the most important (on my opinion) idea on Intellegence Life in the Universe . ... On the problem of the Super Ratio in astrophysics" . ... As a matter of fact, this is the main problem of the modern natural science. ... Here I shall try to speak about the most important problem of the modern natural science, the problem which is undoubtedly, of more importance than discovery of Blacks Holes, creation of Grand Unification Theory or Artificial...

Еще в разделе: (Показать все результаты (>160) - www.pereplet.ru/ )

IEEE Transactions on Computational Intelligence and AI in Games (Special Issue on Brain/Neuronal-Computer Games Interfaces and Interaction), 2013, in press. ... Adapting the P300-based brain-computer interface for gaming: a review Alexander Y. Kaplan, Sergei L. Shishkin, Ilya P. Ganin, Ivan A. Basyul, and Alexander Y. Zhigalov Abstract--The P300-based brain-computer interface (P300 BCI) is currently a very popular topic in assistive technology development. ... Neurophysiol ., vol. 113, pp. ...

Еще в разделе: (Показать все результаты (>63) - brain.bio.msu.ru/ )

• 7th Conference of Biological Psychiatry "Stress and Behavior" -- Moscow, 2003.
• Nonparametric approaches to the description of EEG piecewise stationary
• Other prospects of the change-point based analysis

... The application methods of complex professional benchmarking are discussed; it is also shown how these methods are used in the rating and engineering design of supercomputers. ... Keywords: rating list benchmarking, complex test benchmarking, data intensive systems, multilevel benchmarking, space-temporal memory reference locality, memory reference delay optimization, memory reference tolerate, delay hiding, run-time systems, multithreaded architecture program emulation . ...

Еще в разделе: (Показать все результаты (>182) - num-meth.srcc.msu.ru/ )

• Peer Review Process
• A multilevel approach to algorithm and software design for exaflops
• "Simulation of an ideal quantum computer on a supercomputer 'Lomonosov'"

... A new original method of information processing and secure communications based on the coding of alphabet symbols by stabilized cycles of certain perturbed one-dimensional dynamical systems is proposed. The foundation of the proposed method is ciphering by the one-to-one correspondence between periods of such cycles and certain alphabet symbols. ... We propose an original method of data encoding, which makes use of the possibility of stabilizing the cycles of chaotic maps. ...

Еще в разделе: (Показать все результаты (>65) - chaos.phys.msu.ru/ )

• http://chaos.phys.msu.ru/loskutov/PDF/TechPhLt10_04_engl.pdf
• Activities

Contemporary media environment is formed by dense concentration and interaction of cultures, languages, channels and modalities of communication. ... Across this new terrain, rich, exciting and risky, the new generation of media practitioners, teachers, researchers and public intellectuals is expected to navigate competently and creatively. ... Nor can the idea of intercultural communication be limited (as it was тАУ only recently) to relatively formal contact between established national cultures. ...

Еще в разделе: (Показать все результаты (>12) - discours.philol.msu.ru/ )

• discours
• Free verse and free dance

Выберите категорию обращения: Общие вопросы Отчеты Рейтинги Диссертационные советы Конкурсы Ввод данных Структура организаций Пользователи Проблемы с регистрацией\входом в систему . ... Войти в систему . ... Physiol , Neurosci Behav Physio , Neurosci Behav Physiol показать полностью.. Neurosci, Behav. ... Behavioral Physiology , Neurosci. аnd Behav. Physiol , Neuroscience & Behavioral Physiology , Neuroscience Behavioral Physiology , Neuroscience Behavioral Physiology , Neuroscience and Behav. ...

Еще в разделе: (Показать все результаты (>2368) - istina.msu.ru/ )

• Troitsky S.V. - сотрудник | ИСТИНА - Интеллектуальная Система Тематического
• Plant Signaling and Behavior - журнал | ИСТИНА - Интеллектуальная Система
• Polym. Chem - журнал | ИСТИНА - Интеллектуальная Система Тематического

... VaST is a software tool for finding variable objects on a series of astronomical images. ... VaST performs object detection and aperture photometry using SExtractor on each image, cross-matches lists of detected stars, performs magnitude calibration with respect to the first (reference) image and constructs a lightcurve for each object. ... VaST FITS image viewer ./pgfv . ... Part I" PZP, vol. ... K. V. Sokolovsky, S. A. Korotkiy; "New Variable Stars Discovered by the NMW Survey" PZP, vol. ...

79. FPGA Design

80. A Little History