The Self-Organization of the Cellular Environment and the Reproduction of the Network Logical Structure M.V. Medvedeva, V.A. Koloskov, State Technical University, Kursk, Russia mariya_medvedeva@hotmail.com Keywords: fault tolerance, multicontroller network, recovery from faults, parallel distributed computations, cellular algorithm, backup copies. ... The graph [pic] describes the quality characteristics of the recustomizing routes from the faults' location to the backup nodes. ... M, [pic] j ( 1,2,.. ...

Еще в разделе: (Показать все результаты (>70) - acat02.sinp.msu.ru/ )

• http://acat02.sinp.msu.ru/presentations/GGtut/Dev-02-Basics1.pdf
• http://acat02.sinp.msu.ru/poster-sessions.html
• http://acat02.sinp.msu.ru/presentations/litinski/litinski.doc

... CompHEP Models. ... CompHEP is based on an idea of the physical model. ComHEP Models are very simular to physical models in high energy physics, like Standards Model or MSSM. ... Two of them are versions of the Standard Model (SU(3)xSU(2)xU(1)) in the unitary and t'Hooft - Feynman gauges. ... Standard Model in Feynman gauge . ... This output can be written in LaTeX format and in the form of CompHEP model files, which allows one to start calculations of processes in the new physical model. ...

Еще в разделе: (Показать все результаты (>19) - comphep.sinp.msu.ru/ )

• news [CompHEP]
• extra:main [CompHEP]

... 3 Basic ?metaphisics? Systemic nature of morphological disparity (BD) BD structure is interrelation among BD forms Structural approach to BD investigation implies analysis of interrelations among BD forms Systemic nature of BD presumes that interrelations among BD forms are in part causal At least some of BD forms could constitute a part of causulities affecting certain properties of some other BD forms 4 Basic ?metaphisics? ...

Еще в разделе: (Показать все результаты (>1436) - zmmu.msu.ru/ )

• Igor Ya
• Small mammals of some undeveloped area in Saint-Petersburg
• XIV International Ornithological Conference of North Eurasia: Abstracts

... Institutes of Chernogolovka . The largest of all the scientific institutions of the center is the Institute of Chemical Physics in Chernogolovka , where fundamental problems of chemical physics are studied: kinetics and mechanisms of chemical and biological processes; processes of combustion, explosion, and polymerization; and mechanisms of elementary reactions involving high energy particles. ... Developments and Technologies . ...

Еще в разделе: (Показать все результаты (>14) - www.issp.ac.ru/ )

BUILDING UP THE CONCEPT OF MULTIPLICATION IN ELEMENTARY GRADES Dejic M., Milinkovic J., Djokic O. Faculty of Education in Belgrade, Kraljice Natalije 43, 11 000 Belgrade, Serbia, Tel. 381641201934, E-mail: mdejic@panet.rs, jasmina.milinkovic@uf.bg.ac.rs, olivera.djokic@uf.bg.ac.rs Scientific based teaching approach to building basis of a theory is often called "building up a theory." In building up a theory of natural numbers we may distinguish two approaches: axiomatic and set based approach. ...

Еще в разделе: (Показать все результаты (>447) - www.mce.biophys.msu.ru/ )

• Magnetic system with regular structure
• MCE-2016

... История кафедры . ... младших курсов . ... Уважаемые студенты 1-го, 2-го и 3-го курсов! ... Семинар кафедры проходит по пятницам в 15.20 в комн. ... а также на стендах кафедры на 2-м и 4-м этажах. Информацию о более ранних событиях см. в разделе "Жизнь кафедры" . ... 119991, Москва, Ленинские горы, д.1, стр.2, МГУ имени М.В.Ломоносова, физический факультет, кафедра фотоники и физики микроволн . ...

Еще в разделе: (Показать все результаты (>2) - photonics.phys.msu.ru/ )

... The linguistic aspects of the model and the properties of the semantic dictionary ensuring the content analysis with compression of the text structure are considered. Our dictionary resources serve an instru- ment for building a multilevel textual semantic structure. ... Reason (A,B), where SemF(A) = SIT or a whole semantic formula; the same for SemF(B). ... Sem(SIT)R . ... Semantic Resources for Textual Content Compression // Fourth International Conference on Meaning-Text Theory (MTT'09). ...

Еще в разделе: (Показать все результаты (>4) - leontyeva.srcc.msu.ru/ )

• Lexical Resources for Personal Data Recognition in Texts
• Semantic Dictionary for Text Understanding and Summarization

Some additional inquiry information . ... WPGMA . As any cluster method , UPGMA (unweighted pair-group method of analysis) performs the structure of a set of some homogeneous elements ( in our case alignment is a set of amino acid sequences ). ... Firstly, when we calculate correlations between distance matrices on the whole alignment and on separate position (for selecting "diagnostic" positions) - we should be sure that these data are not distorted by multiple repeating of one sequence. ...

Еще в разделе: (Показать все результаты (>5529) - monkey.belozersky.msu.ru/ )

• ETS_3D_conservation
• Inquiry information || Parsimony algorithm
• HTH3_numeration_assumed

... Alignment Sequence . Include picture . No Picture Only Structure Structure and BP numbers Structure and Stem Energy Full Picture . Sequence name . Alignment OR sequence (without name). The usage of Alignment is strongly recommended. Alignment example: . ... ANMF CGCGGGGTAGAGCAGCCTGGTAGCTCGTCGGGCTCATA AQTRNF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAA BGTRF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAT ANMF ATCCTCTCCCCGCC---- AQTRNF ATCCGCCTCCCGGCACCA BGTRF ATCCGCCTCCCGGCACCA . ...

Еще в разделе: (Показать все результаты (>229) - www.genebee.msu.ru/ )

• DIMACS Series in Discrete Mathematics
• Biochemistry (Moscow), Vol
• BioSystems, 30 (1993) 57-63 57

... 7ґ8, 2000 UDC 620.18:65.012.12.001/002 REPRODUCIBILITY OF THE STRUCTURE AND PROPERTIES OF PARTS AND THEIR DESCRIPTION WITHIN THE FRAMEWORK OF NONLINEAR DYNAMICS A. Yu. ... The problem of the reproducibility of complex structures is discussed from the standpoint of the applied theory of dynamic systems. ... The problem of the reproducibility of complex structures that appear in nonlinear media has become closely connected with some problems of the applied theory of dynamic systems. ...

Еще в разделе: (Показать все результаты (>83) - chaos.phys.msu.ru/ )

• http://chaos.phys.msu.ru/loskutov/PDF/PHDK634.pdf
• http://chaos.phys.msu.ru/loskutov/PDF/TMPh_quadratic_cml.PDF
• http://chaos.phys.msu.ru/prokhorov/phd/tmf_eng.pdf

... Key carbonatite localities that have been investigated as part of INTAS project 05-1000008-7938 ? Diamond and Graphite in Carbonate Magmas ? are: (1) Western Greenland, where the distribution of kimberlites , lamproites and carbonatites is correlated with depth to a fossil subducted slab (personal communication, Nielsen 2008); (2) the Chagatai Complex of ... Generation of carbonatitic melt through partial melting of carbonated eclogite under mantle conditions. ...

Еще в разделе: (Показать все результаты (>983) - geo.web.ru/ )

• http://geo.web.ru/conf/alkaline/2009/Asavin2.htm
• http://geo.web.ru/conf/khitariada/5-2000.2/hydroterm17a.eng.pdf
• Tomographic Models

... All Morphological filters are based on two operations -- dilation and erosion . ... It is common to call in the above expressions as an image, and as a structural element. The surface plays the role of the image in the morphological filters used in FemtoScan program (lets define it as ), while the object (shown below) most often plays the role of structural element. ... Filter . ... The filter fulfill the operation erosion over the current image using a selected tip as a structural element. ...

Еще в разделе: (Показать все результаты (>170) - www.spm.genebee.msu.ru/ )

• Reconstruction of 3D Images
• Software structure
• Change in inner data representation

... Consider a matrix S. The element sij of S is equal to the number of inextendible directed sequences from the minimal vertex i to the maximal vertex j . ... Therefore the number of directed sequences from the vertex i to the vertex j is equal to the element wij of a matrix W: N W= k =0 V k , (1 9 ) 6 where N is equal to the number of edges in the graph. ... Tr S is equal to the number of inextendible directed sequences from minimal vertexes to maximal vertexes that have equal numbers. ...

Еще в разделе: (Показать все результаты (>15) - temporology.bio.msu.ru/ )

• http://temporology.bio.msu.ru/EREPORTS/krugly_the-dinamics.pdf
• http://temporology.bio.msu.ru/EREPORTS/krugly_discreet-mechanics.pdf
• http://temporology.bio.msu.ru/EREPORTS/krugly_unfaithful.pdf

... Contemporary State ol SETI Problem In Russia . ... Presently the scientific and technological civilization on Earth possesses only one method of searching for extraterrestrial civilizations in outer space - the method of remote observation by scanning, optical and radio data from the surrounding space and by trying to detect and. recognize possibly intelligent signals. ... Theoretical Foundations ot the Contact oi Intelligent System. ... Intermediary Languages for the Contact ot Intelligent Systems....

Еще в разделе: (Показать все результаты (>290) - lnfm1.sai.msu.ru/ )

• Y.Kupryakov, SAI, MSU
• Data bases of Natural Satellites. Documentation. Structure

... Science Park . ... Agency for networking, information and communication technologies ( NETINFOKOM LLC) ank-nic@rambler.ru http://www.msunews.ru/ . ... Developing the infrastructure and information support needed for projects that provide an interdisciplinary exchange of science information and the potential for collective work on the base of network services and technologies. ... The company has a great deal of experience in the design, development and penetration of laboratory information systems. ...

Еще в разделе: (Показать все результаты (>13) - www.sciencepark.ru/ )

• MSU Science Park - About us

... Based on the concept of -matrix and ChoiґJamiolkowski states we develop the approach of quantum process reconstruction. ... The approach is tested with the statistical reconstruction of the polarization transformations in anisotropic and dispersive media realized by means of quartz plates and taking into account the spectral structure of input polarization states. ... Knowing the input and measured (output) states, one can reconstruct the -matrix of the quantum process. ... Mixed state...

Еще в разделе: (Показать все результаты (>133) - qi.phys.msu.ru/ )

• http://qi.phys.msu.su/papers/2006-pra-73-063810.pdf
• http://qi.phys.msu.ru/kulik/Papers/PRA42303.pdf
• http://qi.phys.msu.su/papers/2006-lasphys-16-1264.pdf

QUANTUM STOCHASTIC PROCESSES This course is for 4-5th year and graduate students. ... It is dedicated to systematic account of Quantum Stochastic Processes right in the form they are actually used in theoretical calculations of Quantum Open Systems. ... LECTURE 2. ... Open systems and quantum stochastic processes. Mathematical definition of an open system and quantum stochastic process. ... Markovian quantum stochastic processes. Formal definition of quantum markovian stochastic process. ...

Еще в разделе: (Показать все результаты (>78) - qilab.phys.msu.ru/ )

• http://qilab.phys.msu.ru/papers/Laser-Phys-Lett-2004.pdf
• http://qilab.phys.msu.ru/papers/PRA22309.pdf
• http://qilab.phys.msu.ru/papers/JCTE-2002-en.pdf

Lomonosov Moscow State University was established in 1755 . ... Lomonosov Moscow State University Diary . ... MSU Online . ... More than 40 000 students (graduate and postgraduate) and about 7 000 undergraduates study at the university, and over 5 000 specialists do the refresher course here. ... Moscow University campus is an extremely complex system, with its 1 000 000 m2 floor area in 1 000 buildings and structures, with its 8 dormitories housing over 12 000 students and 300 km of utility lines. ...

Еще в разделе: (Показать все результаты (>103) - www.msu.ru/ )

• Research Priorities in Sciences and Humanities at Moscow State University
• General Information

Post-Telbessian Strike-Slip-Related Compressional and Extensional Structures in Central Kazakhstan . ... Faults controlled post-telbessian structuring are of Late Devonian - Early Permian age; they are usually deep-seated. ... Thus, post-telbessian structure of Central Kazakhstan has developed under condition of relatively monotonous stress field with sub-longitudal orientation of main compression and latitudal orientation of main extension. ...

Еще в разделе: (Показать все результаты (>22) - sbmg.geol.msu.ru/ )

... Practice of Business The course provides students with practical working experience in companies operating in various areas of business, including finance, communications, consultancies, natural resource management, high-tech and others. ... The course includes writing an industry-specific group report. ... Human resources management (international aspects) The course will provide a basic introduction to the organization of international human resources in business. ...

Еще в разделе: (Показать все результаты (>162) - www.mgubs.ru/ )

• Высшая школа бизнеса МГУ им. Ломоносова
• Вестник Московского университета | Высшая школа бизнеса МГУ им. Ломоносова