hpc@cmc . Высокопроизводительные вычисления на ВМК МГУ . Blue Gene/P . ... Регистрация . ... Серия Blue Gene в мире . ... Доступ по SSH . ... Регламент доступа . ... С 2008 года на факультете ВМК МГУ имени М. В. Ломоносова работает суперкомпьютер IBM Blue Gene/P, который является одной из первых систем данной серии среди установленных в мире. Архитектура Blue Gene была предложена компанией IBM в рамках проекта по исследованию возможностей достижения новых рубежей в супервычислениях. ...

Еще в разделе: (Показать все результаты (>5) - hpc.cmc.msu.ru/ )

... Dr. G. Koptsik . ... Aim of this project is to develop a tool to quantify the risks of excess inputs of heavy metals to agricultural and forest ecosystems. ... Geographically the accent will be put on agricultural and forest ecosystems of the Northern (Kola Peninsula) and Central (Upper Oka-river basin) parts of Russia. ... Koptsik G.N., Nalbandyan K.F. 2002. ... Koptsik, S., Koptsik, G., and Eruslankina, L. Heavy metals in subarctic forest ecosystems: soil pollution and impacts on plant diversity. ...

Еще в разделе: (Показать все результаты (>21) - eco.soil.msu.ru/ )

• Koptsik G.N., et al. Soils of the National Park "Russian North".
• Polluting metals in Russian terrestrial ecosystems: chemistry, dynamics, and
• CLEANSOIL, An innovate method for the on-site remediation of polluted soil

... Results of experimental and numerical investigations of a permeable round parachute with the stripe-stabilizer, the so called "SAL" parachute - Stabilization of Aerodynamic Loads, are given [1]. ... The parachute canopy attained different shapes from each other depending on the value of reefing ( Fig.1 ). ... As given below some numerical investigations of the stripe-stabilizer reefing influence on the canopy shape, its aerodynamic drag and the tension of radial ribbons are considered. ...

Еще в разделе: (Показать все результаты (>7) - margaret.imec.msu.ru/ )

• On Square Parachute Differential Equations

news ]] . ... Highlight news: CompHEP is in the top rating list on The OpenScience Project . ... 16/03/2009 New official version of CompHEP (4.5.1) is available. ... 14/11/2006 Two new versions of CompHEP-PYTHIA interface (cpyth-1.2.7 and cpyth-2.0.4) are available. ... 13/09/2006 A new version of CompHEP-PYTHIA interface and a new interface CompHEP-HERWIG has been released. ... 01/07/2006 Talk on new physics with CompHEP by M.Dubinin at Tools for SUSY and the New Physics (LAPP, 26-28 June 2006). ...

Еще в разделе: (Показать все результаты (>21) - comphep.sinp.msu.ru/ )

• faq [CompHEP]

A Short Course in Differential Geometry and Topology A.T. Fomenko and A.S. Mishchenko sP A Short Course in Differential Geometry and Topology A.T . ... Partition of Unity 2.4.1 Functional separability 2.4.2 Partition of unity 3 CONTENTS 51 52 54 Smoot h Manifolds (General Theory ) 57 3.1 Concept of a Manifold 59 3.1.1 Main definitions 59 3.1.2 Functions of change of coordinates. ... Frenet formulae 4.1.2 Theory of spatial curves. ... Examples and illustrations are included throughout the chapter. ...

Еще в разделе: (Показать все результаты (>222) - higeom.math.msu.su/ )

• Conferences (English)
• Topology section
• Alexey Garber

Summary Progress Report 2010 ґ 2014 UNESCO Chair on Global Problems and Emerging Social and Ethical Challenges for Large Cities and Their Population at the Faculty of Global Processes of the Lomonosov Moscow State University Period of activity: September 2010 June 2014 Title of the Chair : UNESCO Chair on Global Problems and Emerging Social and Ethical ... Visit of UNESCO Director-General Irina Bokova at Moscow State University September 9, 2011. ...

Еще в разделе: (Показать все результаты (>67) - fgp.msu.ru/ )

• http://fgp.msu.ru/wp-content/uploads/2014/09/UNESCO_CHAIR-2.pdf

О кафедре . ... Наглядная и компью терная геометрия и топология . ... Г.В.Носовский. ... Математические заметки, т. 33, вып. 2, 1985, с. 325-333. ... Об условиях, возникающих при оценке производных решений стохастических дифференциальных уравнений в римановых пространствах.. ... Тезисы Бакинской международной конференции по топологии и ее приложениям. ... В.В.Калашников, Г.В.Носовский, А.Т.Фоменко. ... Г.В.Носовский, А.Т.Фоменко. ... Вып. ... А.А.Голованов, Д.П.Ильютко, Г.В.Носовский, А.Т.Фоменко. ...

Еще в разделе: (Показать все результаты (>81) - dfgm.math.msu.su/ )

• Conference dedicated to the memory of Professor Yu. P. Solovjev
• Иванов А.О. / Кафедра Дифференциальной геометрии и приложений /
• Фоменко А.Т. / Кафедра Дифференциальной геометрии и приложений /

Вы посетили: conf_engl.html . ... International Algebraic Conference dedicated to 70th birthday of professor A.V. Mikhalev, Russia, Moscow, November 2010 . ... International Algebraic Conference dedicated to the 100-year anniversary of professor A.G. Kurosh, Russia, Moscow, May 2008 . ... 2nd International Conferences on Matrix Methods and Operator Equations, Russia, Moscow, July 2007 . ... staff/guterman/conf_engl.html.txt Последние изменения: 13.02.2013 11:26 (внешнее изменение) | ...

Еще в разделе: (Показать все результаты (>24) - halgebra.math.msu.su/ )

• staff:guterman:conf_rus.html | Кафедра высшей алгебры

Head of sector, acting head of the Computational Geophysics Division of the M.V. Keldysh Institute for Applied Mathematics, RAS. ... Finished the Electrodynamics and Quantum Theory Department of Faculty of Physics, MSU in 1962. ... Ill-posed problems, stochastic processes, theory of approximation. Mechanics and physics of multi-phase media, phenomena in porous media, difference schemes for some classes of mathematical physics problems (filtration, elasticity theory). ...

Еще в разделе: (Показать все результаты (>11) - compmech.math.msu.su/ )

• Список публикаций - А. Н. Козлова - Кафедра вычислительной механики

... The technique had been developed for calculating destruction of melting vitreous bodies in hypersonic gas flows taking into account the internal radiative transfer. ... The problem of flow in the chemically non-equilibrium boundary layer at a stagnation point of blunt body had been solved by the asymptotic method and formulas for the heat and diffusion fluxes to a surface of any catalycity had been obtained. ...

Еще в разделе: (Показать все результаты (>9) - lab106.imec.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>3) - mouse.genebee.msu.ru/ )

Combination of high resolution mass -spectrometry (FT-ICR) and nuclear magnetic resonance ( NMR ) for analysis of mumijo (shilajit) Gleb Vladimirov1, Anton Grigoryev1,5, Alexey Kononikhin1,2, Norbert Hertkorn4, Andrey Konstantinov3, Irina Perminova3, Igor Popov1.2, Eugene Nikolaev1,2 Institute For Energy Problems of Chemical Physics RAS, Moscow , Russia Institute of Biochemical Physics RAS, Moscow , Russia 3 Lomonosov Moscow State University, ...

Еще в разделе: (Показать все результаты (>137) - mgumus.chem.msu.ru/ )

• http://www.mgumus.chem.msu.ru/publication/2010/2010-grigoryev-transhumus.pdf
• http://www.mgumus.chem.msu.ru/publication/2010/2010-kazachkov-optimization.pdf

BOOKMARK [0][-]{chapter*.2}{Foreword}{}% 1 \ BOOKMARK [0][-]{chapter.1}{The Data }{}% 2 \ BOOKMARK [1][-]{section.1.1}{Origin of the data }{chapter.1}% 3 \ BOOKMARK [1][-]{section.1.2}{Population and sample}{chapter.1}% 4 \ BOOKMARK [1][-]{section.1.3}{How to obtain the data }{chapter.1}% 5 \ BOOKMARK [1][-]{section.1.4}{What to find in the data }{chapter.1}% 6 \ BOOKMARK [2][-]{subsection.1.4.1}{Why we need the data ...

Еще в разделе: (Показать все результаты (>281) - herba.msu.ru/ )

• http://herba.msu.ru/shipunov/school/biol_240/en/visual_statistics.toc
• Algologia. Vol.7, No. 3
• The variability of different Drosera

Lomonosov project . ... Scientific goals . ... Gamma-bursts . ... Scientific equipment . ... BDRG . ... ShOK . ... Information unit (BI) . ... Three complexes of scientific equipment onboard ?Lomonosov? satellite will provide multi-wave measurements of gamma-bursts , which are necessary for the studies of the nature of these astrophysical sources. These complexes are BDRG, ShOK and UFFO providing gamma-bursts? measurements within optics, gamma, X-ray and UV-ranges of electromagnetic spectrum. ...

Еще в разделе: (Показать все результаты (>24) - lomonosov.sinp.msu.ru/ )

• DEPRON | Университетский спутник "Ломоносов"
• IMISS-1 | Университетский спутник "Ломоносов"
• ELFIN-L | Университетский спутник "Ломоносов"

SVETKA, a program for analysis of different alignments . Back to the help page . ... Such a feature can look like " Leucine in the position 362 of the alignment of the entire family " and can, in many cases, be a "decision rule" to distinguish sequences from two sides of a tree branch. ... Comparing the alignment with an input tree (the tree may be entered by the user or reconstructed with the WPGMA algorithm), the program detects supporting positions of the alignment for every branch the tree. ...

Еще в разделе: (Показать все результаты (>41) - monkey.belozersky.msu.ru/ )

• About authors ot this complex

О лаборатории . ... Лаборатория теоретической биофизики . ... In our previous article (<a href=? http://erg.biophys.msu.ru/wordpress/archives/706 ? ... Here we generalize this technique for the  two-dimensional space. ... Let us demonstrate how the discrete Laplacian is used in explicit scheme of solving the reaction-diffusion system . ... Нет комментариев " Reaction-diffusion systems in 2D space with python " . ... Reaction-diffusion systems in 2D space with python . ... 2016 ERG Research Group . ...

Еще в разделе: (Показать все результаты (>32) - erg.biophys.msu.ru/ )

Title Should Be in Bold, 18-Point Type and Centered, Please Use Title Case Author name(s) [10-point type, centered, bolded] Author affiliation and full address (8-point type, centered, italicized) Author e-mail address: (8-point type, centered, italicized) Abstract: Indent left and right margins 0.5 in. (1.27 cm), justify the paragraph (on both right and left), and use the same font as in the body of the paper. ... 5] Author(s), "Title of paper," in Title of Proceedings, Name(s), ed(s)., ...

Еще в разделе: (Показать все результаты (>10) - iconolat13.phys.msu.ru/ )

... This file can be created using ''' trac -admin env deploy dir ''' command which automatically substitutes required paths. {{{ #! python import os os. environ [' TRAC _ENV'] = '/ usr / local / trac /mysite' os. environ [' PYTHON _EGG_CACHE'] = '/ usr / local / trac /mysite/eggs' import trac .web.main application = trac .web.main.dispatch_request }}} The ` TRAC _ENV` variable should naturally be the ... Using this method may lead to Trac delivering the content of another Trac environment. ...

Еще в разделе: (Показать все результаты (>984) - kodomo.cmm.msu.ru/ )

• Help: bisect
• TracModWSGI тАУ Tanchiki

DNS Security, Stability and Resiliency John Crain Chief Technical Officer April 21st 2009 Garmisch 1 Monday, 20 April 2009 Agenda Ї The Global DNS SSR Symposium Ї Problems and Opportunities Ї Questions? ... The level of awareness with respect to the DNS is very low" ґ All quotes from Symposium Report 7 Monday, 20 April 2009 Problems & Opportunities 8 Monday, 20 April 2009 Problem: Ї There is a need for training across all sectors of the industry to raise both skills and awareness. ...

Еще в разделе: (Показать все результаты (>13) - iisi.msu.ru/ )

О кафедре . ... Динамические задачи теории упругости . Динамика пластин и оболочек . ... Методы теории упругости . ... Нелинейная теория упругости . ... Пластины и оболочки . ... Теория и расчет оболочек тонкостенных летательных аппаратов . ... Теория упругости структурно-неоднородных тел . ... Уравнения изгиба пластин классическая линейная теория. ... Колебания пластин. ... Oscillation of plates . ... МГУ им. М.В.Ломоносова, механико-математический факультет, кафедра теории упругости . ...

Еще в разделе: (Показать все результаты (>5) - elast.math.msu.su/ )