... Форумы > Аспирантура > Тема . ... PhD позиция в Гренобле, Франция . Горячая PhD-позиция на альпийском курорте во Франции!! ... Шлите резюме на stephane.redon_at_inria.fr, s.grudinin_at_fz-juelich.de . ... Title: Generalized Adaptive Molecular Dynamics . ... One way to understand molecular mechanisms is through modeling and simulation. ... We now want to generalize the adaptive simulation theory. ... Сайт работает с 29.08.2000, Copyright 2000 2011 MMOnline.Ru and MMForce.Net, . ...

Еще в разделе: (Показать все результаты (>90) - www.mmonline.ru/ )

• MMOnline | Форумы | Аспирантура | MSc/PhD in Computer Science at Clemson
• MMOnline | Форумы | Книжная барахолка | Ищу: Knuth, Donald E. Selected Papers
• MMOnline | Форумы | Книжная барахолка

... I. Bogdanova, R. F. Galeevb, S. P. Kulikb, and E. V. Morevac a Institute of Physics and Technology, Russian Academy of Sciences, Moscow, 117218 Russia b Faculty of Physics, Moscow State University, Moscow, 119992 Russia c Moscow Engineering Physics Institute (State University), Moscow, 115409 Russia Received October 12, 2006 Abstract--A model that approximately takes into account instrumental errors in problems of precision reconstruction of quantum states is considered. ...

Еще в разделе: (Показать все результаты (>90) - qi.phys.msu.ru/ )

• http://qi.phys.msu.ru/kulik/Papers/PRA42303.pdf
• http://qi.phys.msu.ru/papers/2011-pra-84-042108.pdf
• http://qi.phys.msu.ru/kulik/Papers/JETP10_03KrivitskiiLO.pdf

PhD Summer School on Scentific Computing . ... Paula Carroll, University College, Dublin, Ireland . ... Irina Fedulova and Sergey Pevtsov, Moscow State University, Russia . ... John Houlihan, Waterford Institute of Technology, Ireland . ... Jimmy McGibney, Waterford Institute of Technology, Ireland . ... Micheal O hEigeartaigh, Waterford Institute of Technology, Ireland . ... Paul O'Kelly, Waterford Institute of Technology, Ireland . ... Michael Ryan, Waterford Institute of Technology, Ireland . ...

Еще в разделе: (Показать все результаты (>47) - angel.cs.msu.su/ )

• : Class Dimension

... Only by numerical simulation. ... moment T (K) Dipole moment (D) Experiment Other example: Diffusion constant 200 250 298 350 400 2.40 2.37 2.48 2.59 2.80 2.25 The Distribution functions: radial distribution function 1 g (r) = N t =1 j i N TS N pair ( r - rij ) The Distribution functions: radial distribution function CC def 2 Work mode ­ computer related 1) · Perform simulation , create trajectory file · Calculate properties timestep by timestep 2) · Perform ...

Еще в разделе: (Показать все результаты (>8) - www.elch.chem.msu.ru/ )

... Главная -> Фильмы -> Frequency . ... Фильмы . ... Frequency . ... Melissa Errico . ... Richard Sali . ... Brian Greene . Melissa Fitzgerald . ... Brian Smyj . ... Richard Nixon . ... Правда, у него есть брат, а у брата есть любознательный сынишка, который роется в подвале дома дяди Джона и находит там древний ламповый радиопередатчик, в свое время принадлежавший отцу Джона Фрэнку Салливану (Дэннис Куэйд). ... Охуетительнейший фильм!! ... да!!!!!!! суперский фильм!! ... Офигенно классный фильм. ...

Еще в разделе: (Показать все результаты (>813) - kinfo.ru/ )

• Strange Frequency 2 - Фильмы - Kinfo.ru
• Frequency Zero - Фильмы - Kinfo.ru
• Strange Frequency - Фильмы - Kinfo.ru

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>8) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

О лаборатории . ... Лаборатория теоретической биофизики . ... In our previous article (<a href=? http://erg.biophys.msu.ru/wordpress/archives/706 ? ... Here we generalize this technique for the љtwo-dimensional space. ... Let us demonstrate how the discrete Laplacian is used in explicit scheme of solving the reaction-diffusion system . ... Нет комментариев " Reaction-diffusion systems in 2D space with python " . ... Reaction-diffusion systems in 2D space with python . ... 2016 ERG Research Group . ...

Еще в разделе: (Показать все результаты (>16) - erg.biophys.msu.ru/ )

... This information is needed for description of interaction of atom and ion with charge particles and photons. ... The project calculations are based on variational method and wave function expansion in a linear combination of hydrogen - like functions with effective charges. wave function of atoms, wave function of ions, cross section calculations, helium-like, variational method, Hartree - Fock, excited states, ionization, single excitation, double ionization, double excitation . ...

Еще в разделе: (Показать все результаты (>12) - cdfe.sinp.msu.ru/ )

... Simultaneous measurement of characteristics of bending and valence bands of water in D2 O solutions, KBr and KCl and using genetic algorithms in conjunction with variation methods allowed increasing accuracy of estimation of Fermi resonance coupling constant and of Fermi resonance contribution into formation of water Raman valence band. ... This energy transfer can explain existence of the shoulder in low-frequency part (in the region 3300 cm-1 ) of water Raman valence band. ...

Еще в разделе: (Показать все результаты (>28) - rswater.phys.msu.ru/ )

• http://rswater.phys.msu.ru/en/articles/2014/Application.pdf
• http://rswater.phys.msu.ru/Assets/Water/OMNN_2010.pdf
• http://rswater.phys.msu.ru/Assets/Water/LasPhys2005.pdf

... Traditionally this relationship was approximated by a power law, but recent theories predict a triphasic Species Area Relationship (SAR) in logarithmic space characterized by steeper increases in species richness at both small and large spatial scales · Range sizes were drawn from the empirical frequency distributions of each taxon and domain (black areas in Supplementary Fig . 3) and were placed into a ... 2012) Universal species­area and endemics­area relationships at continental scales...

Еще в разделе: (Показать все результаты (>95) - herba.msu.ru/ )

• Investigation of thrown out Aurelia aurita

... Data . ... The RELEC experiment was specially developed for study of relativistic electrons in near-Earth space together with TLEs in order to test possible connection between these two phenomena. RELEC mission includes x-ray and gamma-ray spectrometer, 3-axis detector for electrons, UV and red-light flash detector, fast optical imager, low-frequency and radio-frequency analyzers of electromagnetic field and waves. ... Electrons 570-850 keV . ... Gamma-rays 50-420 keV + Electrons 0.2-3.15 MeV . ...

Еще в разделе: (Показать все результаты (>15) - smdc.sinp.msu.ru/ )

Atoms as rods and clocks in a gravitational field A.I.Nikishov Leb edev Physical Institute, Moscow 14th Lomonosov Conference. 19-25 August 2009 Abstract We consider the implications of using an atom as a rod and a clock in a constant gravitational field. One consequence of this is that the space metric of any constant gravitational field should be locally isotropic. ... In general this approach agrees with general relativity only in linear approximation and this is quite surprising. ...

Еще в разделе: (Показать все результаты (>155) - nuclphys.sinp.msu.ru/ )

• http://nuclphys.sinp.msu.ru/mirrors/1996_7b.pdf
• http://nuclphys.sinp.msu.ru/school/s08/s08_15.pdf
• http://nuclphys.sinp.msu.ru/mirrors/1999_6b.pdf

Support ] [ Links to DC resistivity and IP software in WWW ] . ... TRF_2D for Windows - Automated 2D Inversion Program for VES Travers Data. ... The scientists of the laboratory are developing algorithms and computer programs for decision of forward and inverse problems of resistivity and induced polarization methods, which are widely known in Russia and are applied in many countries abroad. ... IE2DL - the set of the programs for resistivity and IP data modeling in 2D inhomogeneous media . ...

Еще в разделе: (Показать все результаты (>28) - www.geol.msu.ru/ )

Psychology in Russia: State of the Art Volume 6, Issue 3, 2013 Russian Psychological Society Lomonosov Moscow State University automated real-time classification of functional states: significance of individual tuning stage Vladimir V. Galatenko, Evgeniy D. Livshitz, Alexander M. Chernorizov, Yury P. Zinchenko, Alexey V. Galatenko, Vladimir M. Staroverov, Sergey A. Isaychev, Vyacheslav V. Lebedev, Galina Ya. ... In rare cases (e.g., individual M14_A7), individual tuning slightly reduces reliability. ...

Еще в разделе: (Показать все результаты (>99) - www.psy.msu.ru/ )

... N.5, pp.592-597 (scanned PDF file, English version) . ... A.V.Shanin, Embedding formula for electromagnetic diffraction problem // Zapiski seminarov POMI, V.324, pp.247-261 (2001), in Russian, (PDF file, Russian version) (PDF file, English version) . ... PDF file) . ... Shanin A.V., Coordinate equations for the Laplace-Beltrami problem on a sphere with a cut // QJMAM, 2005 (58) 2, 1-20 The preprint versions of two previous papers have been sent to URSI contest: Paper 1, PDF file , Paper 2, PDF file ...

Еще в разделе: (Показать все результаты (>47) - acoustics.phys.msu.ru/ )

... Living systems depository "Noah's Ark" . ... About the project . ... The project of the Moscow State University "Noah's Ark" is dedicated to the creation of multi-functional network storage of biological material. ... Creation of temporary prototypes of living systems depository bank for storage and research of the collected material. ... Development of algorithms for the information processes analysis in living systems for receiving, filing and processing of various types of biological data. ...

77. A.Yu. Veretennikov

78. INTAS 95-525 Final Reprort (Short version)

79. http://selena.sai.msu.ru/Bus/Publications/m44_14_busarev_etal.pdf

80. http://www.philol.msu.ru/~rkigf/P_Objavlenija/Konferencii/Konferencii_2011/2011_09_Grec_form2011.pdf