... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>12) - mouse.genebee.msu.ru/ )

... CUDA Center of Excellence | MSU . ... Lomonosov Moscow State University (MSU) was awarded an NVIDIA CUDA Center of Excellence (CCOE) in 2011 for being one of the first Russian universities to recognize the importance of emerging GPU technologies and first to embrace CUDA. ... Lomonosov Moscow State University (MSU) is renowned as one of the leading computer science centers excelling in application of computational resources to address most vital scientific problems. ...

Еще в разделе: (Показать все результаты (>3) - ccoe.msu.ru/ )

... M.V.Lomonosov Moscow State University , . ... M.Sc. in Physics (Solid State Physics), Department of Physics, M.V.Lomonosov Moscow State University . ... Doctor of Sciences in Physics and Mathematics (Theoretical and Computational Chemistry), Department of Chemistry, M.V.Lomonosov Moscow State University . ... Quantum Chemistry and Computational Chemistry . ... Polyakov I, Grigorenko B , Moscovsky A, Pentkovski V, Nemukhin A // CHEMICAL PHYSICS LETTERS V556, P251-255 (2013) . ...

Еще в разделе: (Показать все результаты (>23) - lcc.chem.msu.ru/ )

• Laboratory of Chemical Cybernetics

... Seminars . ... Group 417 [ PDF ] Students are expected to attend lectures and seminars which is the standard forum for class communication. ... Some of the homework problems might appear on the tests and the exam. ... Your class grade total percentage is given by 40% seminar and homework, 25% first test and 35% second test. ... Students with the class grade 5 and 4 may get a final course grade without a final exam, but only upon the recommendation of seminar assistants. ... Test 1 [ PDF ] . ...

Еще в разделе: (Показать все результаты (>60) - nanofluidics.phys.msu.ru/ )

• Laboratory of Micro- and Nanofluidics
• Demekhin
• Theses

Cell Biology International 27 (2003) 293­294 Cell Biology International www.elsevier.com/locate/jnlabr/ycbir Short communication Microtubule dynamics in living cells : direct analysis in the internal cytoplasm Ivan A. Vorobjev a a,* , Irina B. Alieva a, Ilya S. Grigoriev b, Gary G. Borisy c Laboratory of Cell Motility, A.N. Belozersky Institute, Moscow State University, Moscow, Russia b Department of ... These data demonstrate that MT growth is impeded at the cell margin. ...

Еще в разделе: (Показать все результаты (>40) - cellmotility.genebee.msu.ru/ )

• http://cellmotility.genebee.msu.ru/html/articles/vorobjev83.pdf
• Alieva Irina

... Russian . The Astronomical Circular (Astronomicheskii Tsirkulyar) is published online by the Eurasian Astronomical Society and Sternberg Astronomical Institute, Moscow State University. ... All papers are refereed. All published papers are indexed in the SAO/NASA Astrophysics Data System . ... See this directory for sample files (template for a paper in English and in Russian , style file , sample figure and sample PDF file for a paper in English and in Russian ). ...

Еще в разделе: (Показать все результаты (>123) - comet.sai.msu.ru/ )

• Multiwavelength Study of Mira Ceti-Type Variable Stars
• Rudnitskij Georgij M. Home Page
• Saving the results of a sort to a file

General Information . ... Symposium expenses . ... Presentation information . ... Travel information . ... 14 European Symposium on . Gas Phase Electron Diffraction . ... From metro station "Belorusskaya" (green line) travel to metro station "Teatral'naya" (green line). ... From metro station "Paveletskaya" (green line) travel to metro station "Teatral'naya" (green line). ... After that make a change to "Biblioteka imeni Lenina" (red line) and travel on to metro station 'Universitet' (red line). ...

Еще в разделе: (Показать все результаты (>15) - ged.chem.msu.ru/ )

• News. 14 European Symposium on Gas Phase Electron Diffraction
• General Information. 14 European Symposium on Gas Phase Electron Diffraction
• Contact information. 14 European Symposium on Gas Phase Electron Diffraction

W e are happy to greet you, young people who have decided to devote themselves to studying the fundamental laws of nature in all their manifestations ranging from tiny particles of the microworld to the infinite depths of megaspace! Lomonosov Moscow State University is the first University of Russia and one of the leading Universities of the world. T he system of higher physics education at our faculty has been universally recognized. ... Faculty of Physics Dean . ...

Еще в разделе: (Показать все результаты (>42) - foroff.phys.msu.ru/ )

• A GLIMPSE BACK INTO THE HISTORY
• Map of the Campus
• Professor Yagola and his group

Singularly p erturb ed problems with b oundary and internal layers Adelaida B. Vasilieva Lomonosov Moscow State University, Moscow , 119991, Russia e-mail: ABVAS@phys.msu.ru Valentin F. Butuzov Lomonosov Moscow State University, Moscow , 119991, Russia e-mail: butuzov@phys.msu.ru Nikolay N. Nefedov Lomonosov Moscow State University, Moscow , 119991, Russia e-mail: nefedov@phys.msu.ru Nonlinear singularly ...

Еще в разделе: (Показать все результаты (>44) - pont2008.cmc.msu.ru/ )

• http://pont2008.cs.msu.ru/files/en/abstracts/KolesovMishchenkoRozov.pdf
• Organizing Committee International Conference Differential Equations and
• Registration International Conference Differential Equations and Topology

... Seminar archive . ... The structure of the X-ray sources in the hard spectral state of accreting black-hole binaries has been a subject of intense debate. The paradigm dominant for many years postulated that the accretion disc in the hard state is truncated at some radius >> the innermost stable orbit (ISCO) whereas the disc reaches the ISCO in the soft state. ... On the other hand, there have been numerous claims in recent years that the disc extends to the ISCO in the hard state. ...

Еще в разделе: (Показать все результаты (>313) - master.sai.msu.ru/ )

• Общемосковский семинар астрофизиков имени Якова Борисовича Зельдовича

... We apply an additional restrictions on the model which follow from recent helioseismic results: 1) calibration of the surface helium abundance and the specific entropy in the convection zone (Vorontsov et al. ... AAAA AAAA AAAA AAAA AAAA AAAA AAAA AAAA AAAA AAAA AAAA AAAA AAAA AAAA AAAA AAAA AAAA AAAA AAAA AAAA AAAA AAAA AAAA AAAA AAAA AAAA AAAA AAAA AAAA AAAA AAAA AAAA AAAA AAAA AAAA AAAA AAAA AAAA AAAA AAAA AAAA AAAA...

Еще в разделе: (Показать все результаты (>3440) - crydee.sai.msu.ru/ )

• Миронова Ирина. Mironova Irina Home page
• Index of /public/lyrics/cs-uwp/p/presidents.of.the.united.states.of.america
• Final Results: American Pie Lyrics

My Teachers . Kh.A. Rakhmatulin . ... U.M. Dubova-Sergeeva . ... Kh.A. Rakhmatulin's works reflect a wide range of his scientific interests. Fundamental results, obtained by him, have a great scientific and applied significance in many fields of modern mechanics: . ... Meritorious Art Worker of Russia Undina Mikhailovna Dubova-Sergeeva was founder and head of M.Lomonosov Moscow State University Piano Class, from 1936 till 1986. ...

Еще в разделе: (Показать все результаты (>9) - margaret.imec.msu.ru/ )

• Scientific Achievements
• Education
• Homepage

... education . ... Composite materials . Materials for solar and fuel cells . ... Registration deadline is 30 April 2012. ... New deadline is 15 May 2012 . ... Registration fee should be paid before 10 June 2012. ... For information please contact Mrs. Olga Bogomolova: obogomol@gmail.com and Dr. Alexander Chertovich: chertov@polly.phys.msu.ru . ...

Еще в разделе: (Показать все результаты (>63) - nano.msu.ru/ )

• MSU Nanotechnology Education and Research Center. Mission. | MSU Nanotechnology
• Schools | MSU Nanotechnology Education and Research Center
• Events | MSU Nanotechnology Education and Research Center

... Field of interest: Theory of quantum measurements. ... It is proposed the new method of quantum nondemolition measurement of energy of optical wave in waveguide using effect of quadratic scattering of electron or atom. ... Measurement of excess noise in the suspension fiber for a gravitational wave detector'', Physics Letters A , A227 , 159-164 (1997). ... Thermodynamical fluctuations and photo-thermal shot noise in gravitational wave antennae'', Physics Letters A , A264 , 1-10 (1999). ...

Еще в разделе: (Показать все результаты (>105) - hbar.phys.msu.ru/ )

• Michael L. Gorodetsky
• The jump of the second derivative of the moon's elongation

... Radical changes in the life of the country at the end of the twentieth century put the Moscow University within the need of maintaining a high level of classical university education in the new environment. ... In June 2006 the Academic Council of the Moscow State University has decided to establish a new Faculty - Higher School of Management and Innovation (Corporate University) - jointly with JSFC "Sistema" . ... MSU website . ... 2006-2016 MSU Higher School of Management and Innovation. ...

Еще в разделе: (Показать все результаты (>13) - hsmi.msu.ru/ )

• Admission committee | MSU Higher school of management and innovation
• MSU Higher school of management and innovation |
• School overview | MSU Higher school of management and innovation

ChangeLog for / # # Generated by Trac 0.12.5 # 04/11/16 21:39:21 Sat , 04 Dec 2010 20:39:27 GMT darkhan [22:749533cdfc67] * State.py ( modified ) State: readable comments Sat , 04 Dec 2010 20:32:41 GMT darkhan [21:bb4a79cc6b6e] I don't understand... default mercurial: created new head, merged branch Sat , 04 Dec 2010 20:28:47 GMT darkhan [20:eef739e055f4] * Automata.py ( ...

Еще в разделе: (Показать все результаты (>484) - kodomo.cmm.msu.su/ )

• http://kodomo.cmm.msu.su/trac/cca/log/?format=changelog&rev=22%3A749533cdfc67&limit=100&mode=stop_on_copy
• http://kodomo.cmm.msu.su/trac/cca/log/?format=changelog&rev=21%3Abb4a79cc6b6e&limit=100&mode=stop_on_copy
• http://kodomo.cmm.msu.su/trac/cca/log/?format=changelog&rev=bb4a79cc6b6e424a24496b907ff54ff51d63e1c8&limit=100&mode=stop_on_copy

FINDING AREAS OF TYPICAL ARTIFACTS OF IMAGE ENHANCEMENT METHODS A.V. Nasonov, A.S. Krylov Laboratory of Mathematical Methods of Image Processing, Faculty of Computational Mathematics and Cybernetics, Lomonosov Moscow State University, 119991, Russia, Moscow, Leninskie gory, (495) 939-11-29, nasonov@cs.msu.ru, kryl@cs.msu.ru * The paper presents a new method to find areas related to typical artifacts of image enhancements methods. Two artifacts are analyzed: edge blur and overshooting effect. ...

Еще в разделе: (Показать все результаты (>623) - imaging.cmc.msu.ru/ )

• http://imaging.cs.msu.ru/pub/2011.DSPA.Lubimov_Mikheev_Lukin.Clustering.en.pdf
• Image sharpening by grid warping | Laboratory of Mathematical Methods of Image
• View publication | Laboratory of Mathematical Methods of Image Processing

A GENETIC ALGORHYTM FOR OPTIMIZING A NEURAL NETWORK CAPABLE TO LEARN FOR FOOD SEARCHING IN A RADIAL MAZE Budilova E.V., Chepurnova N.E., Chepurnov S.A, Teriokhin A.T. M.V.Lomonosov Moscow State University, Dept. of Biology. ... The upper platform has a hole in the middle and several radially directed tubular canals ("arms") each of which can contain a peace of food and has doors opening only in the centrifugal direction. ... The task of the animal is to visit only those arms which contain food. ...

Еще в разделе: (Показать все результаты (>40) - ecology.genebee.msu.ru/ )

... Главная -> Фильмы -> Altered States . ... Фильмы . ... Altered States . ... США 1980 . ... Bob Balaban . Charles Haid . ... Charles White-Eagle . ... Deborah Baltzell . ... John Walter Davis . ... John Larroquette . ... Adriana Shaw . ...

Еще в разделе: (Показать все результаты (>402) - kinfo.ru/ )

• States of Grace - Фильмы - Kinfo.ru
• The United States of Leland - Фильмы - Kinfo.ru
• Naked States - Фильмы - Kinfo.ru

A very important stage in a story of formation of any new science is the shift from discussion of situation which are possible but do not occur in practice due to some reason to recognition of real phenomena of interest. ... We suggest to consider computer viruses as this new specific form of life which is coming in the contact with our form of life. ... Computer life has been created by human being, the role of independent evolution of computer viruses seems to be still negligible. ...

Еще в разделе: (Показать все результаты (>342) - lnfm1.sai.msu.ru/ )

• http://lnfm1.sai.msu.ru/~rastor/CV.txt
• Celestial Mechanics
• Yuri Nicolaevich Efremov - My Home Page