... Physical Chemistry Division , . Department of Chemistry , . M.V.Lomonosov Moscow State University , . Moscow 119991 Russian Federation . ... Undergraduate student, Special Group for Physical Chemistry, Chemistry Department, Moscow State University. ... Physical Chemistry . ... 2005 - International Mendeleev's Chemistry Olympiad, Tajikistan - Silver Medal . 2006 - International Mendeleev's Chemistry Olympiad, Armenia - Gold Medal . ...

Еще в разделе: (Показать все результаты (>15) - lcc.chem.msu.ru/ )

... 2, 1998 UNEXPECTED RECYCLIZATION OF PYRIDINIUM SALTS TO GIVE OXAZOLES E. V. Babaev and A. A. Tsisevich N-(Acylalkyl)-2-halopyridinium salts (I) are commonly used in the synthesis of azolopyridines with a bridging nitrogen atom. In particular, the formation of imidazo[l,2-a]pyridines and their N-alkyi- and N-aryl derivatives in the reaction of salts I with ammonia and primary amines [1, 2] or aromatic amines [1] is well known. ... Reactions of salts I with secondary amines have not been reported. ...

Еще в разделе: (Показать все результаты (>138) - www.chem.msu.ru/ )

• http://www.chem.msu.ru/eng/misc/babaev/papers/117e.pdf
• http://www.chem.msu.ru/eng/misc/babaev/papers/040e.pdf
• http://www.chem.msu.ru/eng/misc/babaev/papers/017e.pdf

DVM debugger - contents . Part 1 (1 - 4) . ... Writing to read-only variable is detected. ... Using non-initialized element <elem> . ... Using variable <var> before asynchronous reduction competed . ... The dynamic debugger detects access to a shadow element before asynchronous shadow renew competed . ... It is reported when any non-correspondence of trace or loop description file is detected. ... Different values of reduction operation are detected for current event and in reference trace record. ...

Еще в разделе: (Показать все результаты (>60) - sp.cs.msu.ru/ )

• DVM отладчик. Детальный дизайн. Часть 4

Estimation of selection pressure on degenerate sequences in genomes: choice of method I.S. Rusinov,1 A.S. Ershova, 1 2,3,4 A.S. Karyagina, 2,3,4 S.A. Spirin, 1,2,5 A.V. Alexeevski 1,2,5 Lomonosov Moscow State University, Faculty of Bioengineering and Bioinformatics, Moscow 119992, Russia;2Lomonosov Moscow State University, Belozersky Institute of Physical and Chemical Biology, Moscow 119992, Russia; 3Gamaleya Institute of Epidemiology and Microbiology, ...

Еще в разделе: (Показать все результаты (>171) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/19.pdf
• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/48.pdf
• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/141.pdf

Hybrid and Glueball Production on Nuclear Target V.L.Korotkikh, L.I.Sarycheva Moscow State University, Institute of Nuclear Physics 119899, Moscow, Russia e­mail: vlk@lav.npi.msu.su Abstract. We propose an experiment at moderate energies in which A­ dependence of Exotic meson production is measured. The main aim of such study is the measurement of the interaction cross­section of Exotic resonances with nucleon. ... We propose to study the exotic meson production on nuclei at moderate energy. ...

Еще в разделе: (Показать все результаты (>110) - lav01.sinp.msu.ru/ )

• http://lav01.sinp.msu.ru/~vlk/pbarp_mypreprint.ps
• http://lav01.sinp.msu.ru/nir/papers/etaetapi_1.5.pdf

... Length=2222430 Score = 55.4 bits (60), Expect = 6e-08 Identities = 53/68 (78%), Gaps = 0/68 (0%) Strand=Plus/Plus Query 141 TTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTC 200 || Sbjct 1090874 TTACTGGGCTTAAAGCGCCCGTAGCCGGCCCGGCAAGTCGCTCCTGAAATCCCCGGGCTC 1090933 Query 201 AACCTGGG 208 || ... Sbjct 2071246 AGCCGCGGTAATACGG 2071261 Score = 28.3 bits (30), Expect = 8.9 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Plus Query 222 ACTGGCAAGCTTGAG 236 || ...

Еще в разделе: (Показать все результаты (>9) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast.out

TUS/KLYPVE Program for Observation of Extreme Energy Cosmic Rays from Space B.A. Khrenov DV Skobeltsyn Institute of Nuclear Physics of MV Lomonosov Moscow State University Workshop "Cosmic Ray Large Scale Experiments in the Second Decade of the 21st Century" 17 May 2011 TUS/KLYPVE collaboration SINP MSU, JINR (Dubna), RSC "Energia", Consortium "Space Regatta" EWHA University (Seoul, Korea) Puebla University (Mexico) Universities of Japan, RIKEN (Tokyo). ... Digital oscilloscopes for UV flashes. ...

Еще в разделе: (Показать все результаты (>8) - tunka.sinp.msu.ru/ )

• http://tunka.sinp.msu.ru/en/presentation/Ptuskin.pdf
• http://tunka.sinp.msu.ru/en/presentation/horns_vhe.pdf

... UHECR SINP MSU . ... News . ... TUS Ultra high energy cosmic ray detector on-board the Lomonosov satellite . ... According to existing estimations it can be a prominent source of ultra high energy cosmic rays (UHECR). ... In either case, the newly born magnetar is an attractive site for producing ultrahigh-energy cosmic rays (particles with individual energies exceeding 10 18 e V ; UHECRs). ... A new mechanism for the acceleration of ultra high energy cosmic rays (UHECR) is presented here. ...

Еще в разделе: (Показать все результаты (>46) - uhecr.sinp.msu.ru/ )

• Новости КЛПВЭ
• Ultra high energy cosmic ray detector KLYPVE on board the Russian Segment of
• The energy spectrum of X-rays from rocket-triggered lightning

J Supercond Nov Magn (2009) 22: 627­629 DOI 10.1007/s10948-009-0510-9 LETTER Relativistic Quantization of Cooper Pairs and Distributed Electrons in Rotating Superconductors I.E. Bulyzhenkov Received: 29 June 2009 / Accepted: 14 July 2009 / Published online: 7 August 2009 © Springer Science+Business Media, LLC 2009 Abstract Relativistic time synchronization along closed integral lines maintains magnetic flux quantization independently from gravitation. ...

Еще в разделе: (Показать все результаты (>435) - chronos.msu.ru/ )

• http://temporology.bio.msu.ru/EREPORTS/yatskar_interference.html
• A.P.Levich. What we expect from studying time
• Laboratory-chair "Time as a phenomenon of the Universe expansion"

... Why do I see a string of "X"s (or "N"s) in my query sequence that I did not put there? ... BLAST (Basic Local Alignment Search Tool) is a set of similarity search programs designed to explore all of the available sequence databases regardless of whether the query is protein or DNA. ... Filters are used to remove low-complexity sequence because it can cause artifactual hits (please see Q: After running a search why do I see a string of "X"s (or "N"s) in my query sequence that I did not put there? ...

Еще в разделе: (Показать все результаты (>173) - www.genebee.msu.ru/ )

• GeneBee BLAST 2.2.22+ Services Help
• GeneBee BLAST 2.2.8 Services Help
• BLAST Reference Manual Pages

... For full UV energy Euv (erg) radiated in TLE the corresponding number of photons of wavelength =300-400 nm (with average energy 3.5 eV) is: Nph=Euv/3.5в1.6 10-12 (1) We considered 2 options of the pinhole camera focal distance: 1. focal distance is short so that the circle of diameter 40 km is observed by one pixel and 2. focal distance is long so that the 40 km circle is observed in many camera pixels. ... Full energy released in UV in the atmosphere is determined by the pixel signal. ...

Еще в разделе: (Показать все результаты (>3) - cosrad.sinp.msu.ru/ )

• http://cosrad.sinp.msu.ru/experiments/tus/doc/HO2COSPAR2006.pdf
• http://cosrad.sinp.msu.ru/experiments/tus/doc/global2007.pdf

... Seminar archive . ... Seminar archive 2013 19 July . ... Wide-field transient surveys and supernova shock breakout . ... Many transient surveys are performed intensively in these days and time-domain astronomy comes under the spotlight. ... The shock breakout is the bolometrically brightest phenomenon in supernovae but it is difficult to observe the shock breakout due to the short duration and X-ray/ultraviolet-peaked spectra. ... All seminars: . ...

Еще в разделе: (Показать все результаты (>17) - master.sai.msu.ru/ )

Warning : oci_connect(): ORA-12543: TNS:destination host unreachable in / home / swx / public_html / models / sw_forecast.php on line 3 Warning : oci_parse() expects parameter 1 to be resource, boolean given in / home / swx / public_html / models / sw_forecast.php on line 4 Warning : oci_execute() expects parameter 1 to be resource, null given in / home / swx / public_html / models / ...

Еще в разделе: (Показать все результаты (>641) - swx.sinp.msu.ru/ )

• http://swx.sinp.msu.ru/models/get_charea.php

Mathematical Modeling of Complex Information Processing Systems 93 DESIGN OF THE EAS CHERENKOV ARRAY FOR THE CERRA LA NEGRA SITE P. Bello 1 , G. K. Garipov 2 , B. A. Khrenov 2 , O. Martinez 1 , E. Moreno 1 , H. Salazar 1 , A. A. Silaev 2 , L. Villasenor 3 , and A. Zepeda 4 The design of the air Cherenkov detector array for the Cerra La Negra site (an elevation of 4 km) is presented. ... Statistics of the registered EAS depends on a sensitivity area \Sigma of the air Cherenkov array. ...

Еще в разделе: (Показать все результаты (>135) - num-anal.srcc.msu.ru/ )

. To be sent no later than July 15 1999 . Surname First names : . Organisation/Institution: . Mailing address: . Email : . Telephone : . Fax (Full International) : . I expect to attend the Conference: . sure probably . I expect to be accompanied by . I expect to present a paper . Title of paper . Topic of the Conference . I expect to present a poster . Title of poster . Topic of the Conference .

Еще в разделе: (Показать все результаты (>81) - www.fadr.msu.ru/ )

... The "diagrams of minimum expected tsunami arrival time" are shown for 25 coastal sites; the TWS dead zones for each of these sites are distinguished by more frequent isolines (every 1 min). ... I ( is the site name). ... We presented isolines of minimum expected tsunami time for all these sites. ... However, there are also sites, In every such case the minimum expected tsunami time tmin has to be to the minimum tsunami propagation time at the distance R in the direction to the respective settlement....

Еще в разделе: (Показать все результаты (>19) - seac47-2.phys.msu.ru/ )

... A+B A+B* A+B A++B+eA+B+ A*+B AB+C AB+C elastic scattering excitation de-excitation ionization (electron loss) charge transfer (electron capture and loss) transfer of excitation re-arrangement reaction Often these processes are studied by observing collisions of atoms or ions with dilute gases. ... It is to be expected that the electronic excitations during atomic collisions in a solid differ in many details from those in a gas, because the electronic structure of the embedded atoms is different. ...

Еще в разделе: (Показать все результаты (>147) - danp.sinp.msu.ru/ )

• http://danp.sinp.msu.ru/LIIWM/PRLett79_1997_1662NMKab.pdf
• http://danp.sinp.msu.ru/Articles_GSIB/nimb237_235_reviewGCIB_SConductors.pdf
• http://danp.sinp.msu.ru/LIIWM/PhysRevB58_1998_8960Chu.pdf

... Форумы > Аспирантура > Тема . ... Аспирантура в Порту, Португалия . ... Grant call on E-Careers site: . ... Research Grant . ... Position/ Grant: PhD Research Grant. Generic scientific area: Engineering. ... Location: University of Porto, Faculty of Engineering, Department of Informatics Engineering (FEUP-DEI), http://www.fe.up.pt . ... This PhD research grant requires the completion of a PhD at the Department of Informatics Engineering, Faculty of Engineering, University of Porto (FEUP-DEI). ...

Еще в разделе: (Показать все результаты (>62) - www.mmonline.ru/ )

• MMOnline | Форумы | Аспирантура | Аспирантура в Барселоне, 15тыс евро в год,

Team . Team has been working in the field of geoinformation technology more than 20 years. Members of the team have fundamental knowledge and experience both in modern information technology and in seismology. ... Information technology for developing of the map of maximum possible magnitudes (M max ) of expected earthquakes. Information technology for detection of earthquake precursors. ... The technology is supported by geoinformation system named Geo 2.5 . ...

Еще в разделе: (Показать все результаты (>392) - geo.web.ru/ )

• http://geo.web.ru/~ariskin/docs/papers/d08_155.pdf
• Asian Current Research on Fluid Inclusions (ACROFI III) International
• COMAGMAT MODEL

... MASTER Net is 56 square degrees per 1 exposition . ... 06 Dec 2015: GRB 151205B: MASTER-NET early optical observations GCN18665 . ... 18 Nov 2015: GRB 151118A: MASTER-NET optical observations GCN18613 . ... 12 Nov 2015: GRB 151112A: MASTER-NET optical limit GCN18591 . ... 07 Nov 2015: GRB 151107A: MASTER-NET optical observations GCN18565 . ... 31 Oct 2015: Five OTs detected by Global Robotic MASTER Net ATel8232 . ... 02 Oct 2015: GRB 151001B: MASTER-NET early optical observations GCN18380 . ...

Еще в разделе: (Показать все результаты (>30) - observ.pereplet.ru/ )