... Alignment Sequence . Include picture . No Picture Only Structure Structure and BP numbers Structure and Stem Energy Full Picture . Sequence name . Alignment OR sequence (without name). The usage of Alignment is strongly recommended. Alignment example: . ... ANMF CGCGGGGTAGAGCAGCCTGGTAGCTCGTCGGGCTCATA AQTRNF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAA BGTRF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAT ANMF ATCCTCTCCCCGCC---- AQTRNF ATCCGCCTCCCGGCACCA BGTRF ATCCGCCTCCCGGCACCA . ...

Еще в разделе: (Показать все результаты (>154) - www.genebee.msu.ru/ )

• AliGraf - GeneBee Graphical Alignment Help
• Databases
• AliComp - GeneBee Alignment Comparison Help

... The Reflected Wave Caused by Acoustic Pulses . ... The method leads to an algorythmic procedure to define all possible types of motion in a concrete problem and to get the evolution equations accounting the modes interactions. ... Also, more exact evolution equations may be consequently derived. Since the non-periodic flows may be treated, a problem of the reflected wave caused by an acoustic plane pulse is considered in the framework of the present approach. ...

Еще в разделе: (Показать все результаты (>161) - acs366.phys.msu.su/ )

Press release 20 July 2011 New funding for early-career top researchers from anywhere in the world: 730 million for new "ERC Starting Grant" call The European Research Council (ERC) today opens its fifth call for proposals for the "ERC Starting Grants", targeted at early-career top researchers of any nationality, working - or moving to work - in host institutions in Europe. ... Last year, the success rate of Starting Grants proposals was around 15%. ...

Еще в разделе: (Показать все результаты (>38) - ideas.msu.ru/ )

• http://www.msu.ru/int/newpr/7ram/7ram_budz.pdf
• http://ideas.msu.ru/docs/CSA_guide_2008.pdf
• http://ideas.msu.ru/docs/Work_programme_2011.pdf

NET .., .. . ... JScript.NET ( VBScript.NET). ... int C/C++, .NET , , ++ ++ , ++. ... public ScriptEngine( string [] assemblyReferences) { GlobalScope gs = VsaEngine.CreateEngineAndGetGlobalScope( false, assemblyReferences); VsaEngine engine = gs.engine; GlobalScope newGS = new GlobalScope(gs,engine); engine.PushScriptObject(newGS); m_GlobalScope = newGS; } // public object Eval( string scriptText) { // object result = null ; return sScript; } // // static void CollectNamespaces( Assembly ...

Еще в разделе: (Показать все результаты (>9) - imaging.cs.msu.ru/ )

• http://imaging.cs.msu.su/~yurin/Doxyfile

info@intas.be Marie Curie mobility workshop ­ May 2005 Mobility and Research Partnerships 2006 INTAS International Association for the promotion of cooperation with scientists from the New Independent States of the former Soviet Union ( NIS ) info@intas.be Marie Curie mobility workshop ­ May All participants in INTAS funded projects must comply with ALL applicable national laws. ... Joint YSF call INTAS ­ Ukraine 3. Joint YSF call INTAS ­ Uzbekistan 4. others? ...

Еще в разделе: (Показать все результаты (>138) - phys.msu.ru/ )

• http://phys.msu.su/upload/iblock/941/gp2012appform.doc
• http://phys.msu.su/rus/about/structure/admin/EPFL.doc
• http://phys.msu.su/upload/iblock/a95/1stcall.doc

... When embedded within a base document, a URL in its absolute form may contain a great deal of information which is already known from the context of that base document's retrieval, including the scheme, network location, and parts of the url-path. ... Introduction This document describes the syntax and semantics for "relative" Uniform Resource Locators (relative URLs): a compact representation of the location of a resource relative to an absolute base URL. ... 3.1) Base URL embedded in the | ...

Еще в разделе: (Показать все результаты (>5) - hea-www.harvard.edu/ )

• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc2396.txt
• Page has moved

... They include a carbonated diatreme and subvolcanic dykes and sills from the Beara peninsula along the south coast of Ireland, a carbonatite diatreme and related silicocarbonatite dykes from the Chagatai region in Uzbekistan and a selection of ultramafic lamprophyres, carbonatite dykes and calcite kimberlites from southern West Greenland. ... A small carbohydrothermal calcite carbonatite (0.80 wt % SrO ) with fenite cross-cuts the lamprophyre. ... Carbonatites and carbonatites and ‰ carbonatites . ...

Еще в разделе: (Показать все результаты (>19990) - geo.web.ru/ )

• http://geo.web.ru/conf/alkaline/2009/Solovova.htm
• http://geo.web.ru/conf/alkaline/2009/Gerasimova.htm
• http://geo.web.ru/conf/alkaline/2009/Woolley.htm

... Vice-Dean, Physics Department, M.V.Lomonosov Moscow State University . Vice-Director, International Laser Center, M.V.Lomonosov Moscow State University . ... International Laser Center and Faculty of Physics . ... Radiophysics including Quantum Electronics . ... Victor Zadkov's current research interests are in the field of laser physics, interaction of laser radiation with matter, molecular dynamics of photoexcited molecules, coherent control, quantum optics and physics of quantum information. ...

Еще в разделе: (Показать все результаты (>69) - qilab.phys.msu.ru/ )

... PALMA Numbers 1 to 11 Observations of positions of stars and planets May 1984 to May 1998 including Extinction and Meteorological data Copenhagen University Observatory Royal Greenwich Observatory Real Instituto y Observatorio de la Armada en San Fernando 1999 http://www.ast.cam.ac.uk/~dwe/SRF/cmc1-11/readme.txt Informations ... Hour of right ascension (alpha, h) 4. Minute of right ascension (alpha, m) 5. Second of right ascension (alpha, s) 6. Degree of declination (delta, deg) 7. ...

Еще в разделе: (Показать все результаты (>383) - lnfm1.sai.msu.ru/ )

• jg0007
• jg0008
• jg0009

Title Authors Key words Methodological bases of personal qualities research of managers and personnel selection for the public service, security personnel, managers of industrial enterprises A.A. Oseev, A.A. Oseev personal qualities of effective leaders of the civil service, the security sector, industrial enterprises , verification of Weber 's types of social action in empirical models of ...

Еще в разделе: (Показать все результаты (>33) - www.socio.msu.ru/ )

• http://www.socio.msu.ru/vestnik/eng/archive/2015/3/07.pdf
• http://www.socio.msu.ru/vestnik/eng/archive/2015/4/08.pdf
• http://www.socio.msu.ru/vestnik/eng/archive/2015/3/10.pdf

Moscow State University Belozersky Institute of Physico-Chemical Biology . Department of Electron Microscopy is a sub-division of A.N. Belozersky Institute of Physico-Chemical Biology . ... We are interested of how eukaryotic cell is organized, formed and functioned. Since A.N. Belozersky Institute of Physico-Chemical Biology is one of the scientific departments of Moscow State University ? ... Understanding the metaphase chromosome architecture remains a basic challenge in cell biology. ...

Еще в разделе: (Показать все результаты (>9) - cellbiol.genebee.msu.ru/ )

... The two main ways of financing a business, equity financing and debt financing, will be discussed in this chapter. Equity Financing Equity capital is the amount of money that you and/or your partners put into the business or raise from other investors. Equity is not debt. While investors share in the profits (or losses) of the business, their investment is not a loan. ... Debt Financing With your equity capital in place, you are now in a position to approach lenders for a business loan. ...

Еще в разделе: (Показать все результаты (>29) - innovation.msu.ru/ )

• http://www.innovation.msu.ru/english/reportofinvention.doc
• http://www.innovation.msu.ru/english/marketingplanoutline.doc
• Start-Up Company Development :: Управление инновационной политики и организации

THE EDUCATIONAL SYSTEM IN RUSSIA AND IN GREAT BRITAIN Sheina E.D. 1548, , 119180, , . ... Now this theme is very up-to-date because one day every child has to go to school to become clever and well-educated. ... Educational system in Great Britain: The modern system of education consists of early childhood education, primary education, secondary education, higher education. ... High School is completed by passing the exam GCSE (General Certificate of Secondary Education). ...

Еще в разделе: (Показать все результаты (>178) - www.mce.biophys.msu.ru/ )

• Model of special type of school education in scientifical towns

... Head of the Department (since 2006) . ... Moscow State University Shuvalov Award (1995) . ... Graduated from the Physics Department of the M.V. Lomonosov Moscow State University (1980). Research interests: Physics of Semiconductors; Physics of Narrow-Gap Semiconductors; Terahertz Radiation Detectors; Organic Semiconductors, Physics of Semiconductor Nanostructures. Main Results: A range of new effects has been observed on heavily doped lead telluride-based narrow-gap semiconductors. ...

Еще в разделе: (Показать все результаты (>25) - ferro.phys.msu.ru/ )

• Department of General Physics and magneto-ordered matter. Physics Faculty of
• Laboratory of Ferroelectricity
• Laboratory of Rare Earth Intermetallics

... Russian language courses: During academic year Summer courses Full-time Part-time Courses dates: from _____( day )____________( month )_____( year ) to ____( day )___________( month )______( year ) Information for visa support Citizenship __________________________________________(if more than one, please indicate them using comas) Place of birth ____________________________( country )_______________________________________ ____( ...

Еще в разделе: (Показать все результаты (>113) - www.msu.ru/ )

• FACULTY OF PSYCHOLOGY
• The International Russian Language Courses at the Faculty of Philology
• Lomonosov Moscow State University Institute of Russian Language and Culture

Firefly (previously known as the PC GAMESS) is a freely available ab initio and DFT computational chemistry program developed to offer high performance on Intel-compatible x86, AMD64, and EM64T processors. ... At moment, Firefly includes no more than 5% of the legacy code. ... Firefly is freely available for all main PC operating systems: Windows, Linux, and Mac OS X. Firefly supports various Windows versions including Windows 8, Windows 7, Windows Server 2008, Vista, 2003, XP, 2000, NT, and 98/Me. ...

Еще в разделе: (Показать все результаты (>69) - classic.chem.msu.su/ )

• Firefly capabilities
• PC GAMESS version 7.1 to version 7.1.5 update information
• Firefly/PC GAMESS DOCUMENTATION - LARGE SCALE CI, MCSCF, and QDPT2

... List of solitary restriction endonucleases in complete prokaryotic genomes . List of groups of orthologous R-M systems. List of all analyzed genomes. Contains those orthologous groups that include at least one separated R-M system . R-M orthologous group ID . REs alignments . MTases alignment . Group 1 . ...

Еще в разделе: (Показать все результаты (>9246) - mouse.belozersky.msu.ru/ )

• Methyltransferases
• Geometrical core
• Index of /npidb/pdb/pdb_new/scop_contact_type

On a numerical method for solving one-dimensional Stefan-type problems" . Okulov N.A. A finite-difference method for solving one-dimensional one- and two-phase Stefan-type problems with multiple phase boundaries is proposed. The essence of the method is that the problem under study is solved step by step when moving from one time layer to another. ... Keywords: Stefan problem, difference scheme, numerical methods, interphase boundaries . PostScript (in Russian) (1.48MB) . ...

Еще в разделе: (Показать все результаты (>171) - num-meth.srcc.msu.ru/ )

• "A hybrid database (information system) on the molecular spectral constants"
• Reduction of detailed schemes for chemical transformations of formaldehyde and
• Publication Ethics and Publication Malpractice Statement

... IBM PC. ... 1991. ... 1992. ... IBM PC. ­ .: , 1993. 5. - , . 8086/8088. ­ .: , 1987. 6. .. . 1978. 7. . ... 2007. 8. . 1988. 9. .. , - -. ­ .: - , 1989. 10. .. . ... 2011,2012. : http://arch.cs.msu.su : http://arch.cs.msu.su/semestr2 ...

80. MODx Content Manager