... About lab . ... Online Journal "Computer graphics and multimedia" (in russian) . ... Algorithms for calculating parameters of virtual scenes in computer vision tasks . ...

Еще в разделе: (Показать все результаты (>127) - graphics.cs.msu.ru/ )

• MSU Video Codec Comparison | Graphics and Media Lab
• MSU Video Codec Comparison | Лаборатория компьютерной графики и мультимедиа
• Videocodecs tuning | Graphics and Media Lab

... About CIE MSU . Academic Programmes . Admissions . ... Vestnik CIE (in Russian) . ... Homepage > Admissions > . Study Periods . 2014-2015 academic year . ... One academic year programme: . September 2014 - June 2015 . Arrival Dates . ... August 28 October 31 . June 2015 . One and a half academic year programme: . ... STUDY PROGRAMMES AND COURSE DATES . ... September 20 15 - June 20 16 . ... Study Period . ... Recommended Arrival Dates . ... June 2 6 June 29 . ...

Еще в разделе: (Показать все результаты (>21) - www.cie.ru/ )

Friday, December 7th, 2012 . ... No Comments ? Monday, December 3rd, 2012 . Добавлена страничка со списком публикаций сотрудников лаборатории за 2012 год. ... You are currently browsing the Лаборатория лазерной интерферометрии blog archives for December, 2012. ... Публикации за 2010 . Публикации за 2011 . Публикации за 2012 . ... January 2013 . December 2012 . ... January 2012 . ... January 2011 . ... Лаборатория лазерной интерферометрии is proudly powered by WordPress . ...

Еще в разделе: (Показать все результаты (>39) - geo.sai.msu.ru/ )

• November 2011 Лаборатория лазерной интерферометрии
• November 2012 Лаборатория лазерной интерферометрии
• December 2010 Лаборатория лазерной интерферометрии

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>17) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... Институт . ... Студентам . Приветствуем вас на Официальном сайте Русско-германского института науки и культуры. Published by admin on April 6, 2016 under Новости . ... No Comments ? ... 09.00 - 15.30 љ љљ 736 - 1.ГУМ . ... Морозова Е.Б. пн. љ17-00? 18-30, 18-45?20-15, 20-30?21-15љ 1 к., ауд.736 1 ГУМ . ... Башкиров В. М. вторник 15.00-17.00, четверг љ15.00-17.00, 1 ГУМ ауд.736 . вторник 17.00-19.00, пятница 17.00-19.00 1 ГУМ ауд.736 . ... 736 1 Гум) . ... 7361 Гум) . ... December 2011 . ...

Еще в разделе: (Показать все результаты (>2) - rgi.msu.ru/ )

• Русско-германский институт. Новости

... INFORMATICS AND MANAGEMENT: BOLOGNA-STYLE QUALIFICATIONS FRAMEWORKS (INARM) . ... Lomonosov Moscow State University, Faculty of Computational Mathematics and Cybernetics (CMC MSU) . ... 2013, February, Kick-off meeting in Lublin. ... 2013, June, Coordinating meeting at CMC MSU, Moscow. ... 2013, October, Coordinating meeting at CMC MSU, Moscow. ... 2013, December 19, Webinar and coordinating meeting at CMC MSU, Moscow. 2013, December 27, Coordinating meeting at CMC MSU, Moscow. ... CMC MSU ? ...

Еще в разделе: (Показать все результаты (>120) - en.cs.msu.ru/ )

• International project INARM of EU program Tempus-IV

... Новости . ... Музей . антропологии . ... Вестник МГУ Антропология . ... 26 ноября Музее антропологии открылась этнографическая выставка . ... Антропология" . ... Посмотреть фотографии . ... 2008-2010 Научно-исследовательский институт и Музей антропологии им.Д.Н.Анучина . Копирование материалов web-сайта только с разрешения администрации НИИ и Музея антропологии МГУ! ... При использовании материалов, размещенных на сайте НИИ и Музея антропологии МГУ, ссылка на источник обязательна! ...

Еще в разделе: (Показать все результаты (>31) - www.anthropos.msu.ru/ )

... Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika. ...

Еще в разделе: (Показать все результаты (>125) - vestnik.math.msu.su/ )

V Russian-Dutch Workshop "Work Incentives in Russian Industry, 1861-2000: Compensation, Commitment and Coercion" Moscow, September 13-14, 2002 Conference Room (652), Faculty of History, Moscow Lomonosov State University Programme of the Workshop Friday, September 13 Opening session. ... Evolution of Work Incentives in the Russian Metalworking Industry: Case Studies Chair: Andrey Sokolov 14:30-15:15. Andrey Markevich (Institute of Russian History of the Russian Academy of Sciences IRH RAS). ...

Еще в разделе: (Показать все результаты (>6491) - hist.msu.ru/ )

• P h o t o A r c h i v e
• The Evolution of the Russian Tax System in the 19thcentury
• История компании Форда в Европе, 1903-2003

Next: Items that Define Paths Up: The sendmail.cf File Previous: An Example sendmail.m4 File . A few or the items in the sendmail.m4 file are required all the time; others can be ignored if you can get away with defaults. The following sections describe each of the items in the example sendmail.m4 file in more detail. Items that Define Paths . Defining the Local Mailer . ... Domain Name Service Related Items . Defining Names the Local System is Known by . UUCP-Related Items . ...

Еще в разделе: (Показать все результаты (>180) - itpm.msu.su/ )

• HTML 4.0 Specification References
• ITPM MSU Web Page
• All About ifconfig

Welcome , Registration , and other StartingPoints ; TWiki history & Wiki style; All the docs.. ... Line: 1 to 1 . ... Changed: . ... It should correspond to the format of the format parameter. ... Topic:* | ... FAQ\:[\n\r]*([^\n\r]+).*) [[$topic][Answer.. ... SEARCH{ "\.*" scope="topic" regex="on" nosearch="on" nototal="on" order="modified" reverse="on" format="| [[$topic]] | ... SEARCH{ "\.*" scope="topic" type="regex" nosearch="on" nototal="on" order="modified" reverse="on" format="| [[$topic]] | ...

Еще в разделе: (Показать все результаты (>35442) - dualopt1.cmm.msu.ru/ )

• IncludeTopicsAndWebPages - TWiki - TWiki - (printable)
• VarURLPARAM - TWiki - TWiki
• VarURLPARAM - TWiki - TWiki - (printable)

... Data . ... Services . ... Solar energetic particles . ... N -d SW Conditions : Time profiles of the key geomagnetic ( Ap and Dst indices), solar wind (velocity V , density n and temperature T ) and IMF ( B , Bx , By , Bz in GSM) parameters observed in the N day vicinity of the geomagnetic disturbed day. N -d Map of Solar Events : Map of solar surface events occurred within N day vicinity of the moment when the solar wind expansion (which causes the geomagnetic event) started. ... WIND . ...

Еще в разделе: (Показать все результаты (>69) - smdc.sinp.msu.ru/ )

• Cosmos-1686 - Space monitoring data center
• Space Monitoring Data Center
• Space monitoring data center

... Phone: (007) 095-9395197; fax: (007) 095-9395888; e-mail: e@lav01.sinp.msu.ru . ... The term of training - 1-2 years. ... Physics of quark-gluon mesons spectroscopy? ... Scientific chief - Ludmila Ivanovna Sarycheva, professor of the Chair of Cosmic Rays and Physics of Cosmos and leader of Laboratory of Hadron Interactions of SINP MSU senior science researcher, PhD. ... Simultaneously the problem of the solar cosmic ray flare energetic electron sources in the interplanetary space will be studied. ...

Еще в разделе: (Показать все результаты (>44) - foroff.phys.msu.ru/ )

... The RADEN data bank produced at the Department of Chemistry of Moscow State University is designed as well to accumulate published information on radiative parameters of diatomic molecules, as to analyse it and recommend the more reliable values. ... electronic transition moments D ( R ); . ... dipole moments, . ... FACTUAL RECOMMENDED DATABASE contains now the ab initio and experimental electronic transition moments for more than 250 band systems which belong to more than 100 diatomic molecules. ...

Еще в разделе: (Показать все результаты (>133) - electr003.chem.msu.ru/ )

• Evgeny V. Antipov:CV
• Alexander M. Kuznetsov
• CV of N.V. Roznyatovskaya

... Supercomputing Technologies in Science, Education and Industry Almanac Series . ... DRIVER: To develop a model of the interstellar hydrogen distribution in the heliosphere. To apply this model for the analysis of experimental data from different spacecraft. ... The results of the simulations of the formation and evolution of molecular clouds can be used as initial conditions for the current star formation in galaxies. ... Research Computing Center (RCC) of Lomonosov Moscow State University . ...

Еще в разделе: (Показать все результаты (>50) - hpc.msu.ru/ )

• APPLICATIONS: Plasma Physics | Moscow University Supercomputing Center

77. staff:guterman:inv_engl.html | Кафедра высшей алгебры

78. http://www.elch.chem.msu.ru/mole/lecture/kiselev.pdf

79. Firefly and PC GAMESS archives

80. PspoMaterials/LibraryGnomeOrg_Evolution - UNИX