fitshdr_expand - expand/extend FITS-file header fitshdr_expand [options] FITSfile_name . fitshdr_expand utility allows to expand/extend existent FITS headers. FITS MultiExtentionsFiles included). fitshdr_expand is just simple shell script around fitshdr utility. --header-no= NNN . Where NNN - FITS-header's number (0,1,.. ... By default 1. --help . Output a brief help message and exit. --version . Print the version number of fitshdr_expand to standard output and exit. --nobackups . ...

Еще в разделе: (Показать все результаты (>320) - lnfm1.sai.msu.ru/ )

• Natural Satellites Service. Special Ephemerides
• Manpage of FITSHDR_EDIT
• Data bases of Natural Satellites. Documentation. Structure

Geant4 toolkit for simulation of HEP experiments V.Ivanchenko From name of Geant4 collaboration BINP, Novosibirsk, Russia & CERN, Geneve, Switzerland Outline Geant4 history Design and tools Geant4 physics June 2002 release Prospects for future June,24 ACAT-2002 V.Ivanchenko Geant4 2 History 90th: About 100 FORTRAN MC programs in the world. The most popular in HEP GEANT3. ...

Еще в разделе: (Показать все результаты (>52) - acat02.sinp.msu.ru/ )

• http://acat02.sinp.msu.ru/InfoBull2.txt
• http://acat02.sinp.msu.ru/accomod.html

Home . Database of structures of nucleic acid - protein complexes . ... List of complexes . Pfam families . SCOP families . Interaction classes . ... NPIDB . ... Information on SCOP and Pfam domains detected in protein chains is presented. ... Each family has its own web page with the list of entries that include domains of the family. ... List of SCOP domains occurred in DNA-protein and RNA-protein complexes is organized in tree-like form, according to the SCOP classification. ...

Еще в разделе: (Показать все результаты (>5) - npidb.belozersky.msu.ru/ )

... Master . Master net Homepage . ... MASTER-Amur . ... Amb: . Dust: . ... Direct . 23s . ... 45s . ... observed area: . best limit: . Cameras . ... MASTER-Tunka . ... MASTER-Ural . master.kourovka.ru . ... MASTER-Kislovodsk . ... MASTER-Crimea . ... MASTER-SAAO . ... MASTER-IAC . ... MASTER-Argentina . master.sai.msu.ru:8080 . master.sai.msu.ru . ...

Еще в разделе: (Показать все результаты (>8) - master.sai.msu.ru/ )

... Policies to promote environmentally sound production methods; conservation and protection of natural resources; . ... Farm price policy and reduction of agricultural subsidies; . ... Credit; consumer credit; production credit; credit agencies; . Problems related to extension of short-term production credits; medium-term and long-term credits; investment and credit policies: demand and supply; economics, institutions; agricultural debt restructuring; mortgage systems; . ... Markets and trade; . ...

Еще в разделе: (Показать все результаты (>188) - www.fadr.msu.ru/ )

• Report of Paleopedology Commission Business Meeting at XV INQUA Congress
• "EcoPhoto" - Order photo - CD
• Фотоархив "EcoPhoto" - Заказ фото - CD

... Alternative core new atoms (%) . ... An alignment of a set of structures is a set of positions , to each position some atoms from different structures correspond. ... Geometrical core of a set of structures is a subset of alignment positions those atoms are disposed similarly in all structures. ... For any two positions included into geometrical core, the distances between CA atoms of those positions in all structures may differ not more than the value of the parameter "Distance spreading". ...

Еще в разделе: (Показать все результаты (>16) - mouse.belozersky.msu.ru/ )

• S : rm_systems

To see a Russian version of this page, click here . ... Graduated from Moscow State University (MSU), Faculty of Physics in 1976. Ph.D. degree - 1988, MSU. Main field of scientific activities: photometric investigations of various stars, close binary stellar systems and other astronomical objects, including research with use of fast photoelectric photometry with a high time resolution till 1 millisecond. ... New portable photometer . ... Send your mail to: tem@sai.msu.ru ...

Еще в разделе: (Показать все результаты (>15) - uranus.sai.msu.ru/ )

• Irina Glushneva
• SAI graduates 1982

MPI. ... C: #include <mpi.h> 14 MPI MPI- C (case sensitive): error = MPI_Xxxxx(parameter,.. ... Send : , , ґ Receive: , , 27 MPI () MPI - , (blocking) (non-blocking) ґ Blocking: ґ Non-blocking: , 28 MPI (modes) (Mode) Synchronous send Buffered send Standard send Ready send Receive (Completion Condition) ( ), ( ) ( ), 29 MPI ?-? () (MODE) Standard send Synchronous send Buffered send Ready send Receive MPI MPI _ Send MPI _ Ssend MPI _ Bsend MPI _ Rsend ...

Еще в разделе: (Показать все результаты (>5) - angel.cmc.msu.ru/ )

• http://angel.cmc.msu.ru/~ifed/teraflops/Popova_OpenMP.pdf

... SQL- SQL, SQL. ... bind (.. - , ) -. : int bind(int s, struct sockaddr * name, int namelen); 6 -- -, . ... int send(int s, void * buf, int len, int flags); -- -, . ... int close ( int s); -- -. - # include sys/types.h # include sys/socket.h # include sys/un.h # include stdio.h #define ADDRESS mysocket /* */ void main () { char c; int i, s, len; FILE *fp; struct sockaddr_un sa; /* -: */ if ((s = socket (AF_UNIX, SOCK_STREAM, 0)) 0){ perror ( client: socket ); exit (1); } /*...

Еще в разделе: (Показать все результаты (>132) - sp.cs.msu.ru/ )

• Logic and Databases
• DVM system - in English
• Lib-DVM. Interface description

... Toric Topology studies torus actions on manifolds and cell complexes whose orbit quotients have a rich combinatorial structure. ... Research proposal by T.Panov on toric topology for 2007-2009, supported by the grant of the Pierre Deligne Foundation of 2006: English summary , proposal (in Russian) . Research proposal by T.Panov on toric topology for 2011-2013, supported by the grant of the Dynasty Foundation of 2010: English summary , proposal (in Russian) . ...

Еще в разделе: (Показать все результаты (>59) - higeom.math.msu.su/ )

• Geometry and Topology (English)
• Publications (English)
• Conferences (English)

FAST RANK ALGORITHMS WITH MULTISCALE HISTOGRAMS LAZY UPDATING1 M. Storozhilova2, D. Yurin 2,3 3 Laboratory of Mathematical Methods of Image Processing Faculty of Computational Mathematics and Cybernetics Lomonosov Moscow State University Leninskie Gory, Moscow 119991, Russia. mariastorozhilova@gmail.com2, yurin@cs.msu.su3 Rank algorithms propose good solutions for image smoothing and impulse noise removing. ... The main idea of our lazy algorithm is based on histogram updating approach from [2]. ...

Еще в разделе: (Показать все результаты (>90) - imaging.cmc.msu.ru/ )

• View publication | Laboratory of Mathematical Methods of Image Processing

Dubna, May 28 June 2 . ... The public transport connections to Moscow include express trains, suburban trains and bus shuttles which depart from the Savyolovsky Rail Terminal. Train schedule (actual from May 27, 2007): 5 00 , 7 43 , 8 40 , 9 37 , 10 05 (express), 11 40 , 14 32 , 16 50 (express), 17 05 , 19 14 , 20 35 , 21 55 (express), 23 22 . Yo may call +7(495)2859005 or 2669333 for schedule updates. Map of Dubna: . You may find another city map here . 2007 Biophysics dep., ...

Еще в разделе: (Показать все результаты (>21) - www.msm.biophys.msu.ru/ )

• Registration and Fee
• MSM 2007

... Alignment Sequence . Include picture . No Picture Only Structure Structure and BP numbers Structure and Stem Energy Full Picture . Sequence name . Alignment OR sequence (without name). The usage of Alignment is strongly recommended. Alignment example: . ... ANMF CGCGGGGTAGAGCAGCCTGGTAGCTCGTCGGGCTCATA AQTRNF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAA BGTRF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAT ANMF ATCCTCTCCCCGCC---- AQTRNF ATCCGCCTCCCGGCACCA BGTRF ATCCGCCTCCCGGCACCA . ...

Еще в разделе: (Показать все результаты (>163) - www.genebee.msu.ru/ )

• Fasta 3.4
• GEA :: Gene Expression Analysis
• About EMBnet

... Issues of the year 2010 . ... Instructions for Authors . ... The scientific English language journal ?GEOGRAPHY, ENVIRONMENT, SUSTAINABILITY? aims at informing and covering the results of research and global achievements in the sphere of geography, environmental conservation and sustainable development in the changing world. ... In the text the surname of the author and the year of publication of the reference should be given in square brackets, i.e. [Author1, Author2, 2008]. ...

Еще в разделе: (Показать все результаты (>152) - www.geogr.msu.ru/ )

• ГРАНТЫ НА ПРОВЕДЕНИЕ ИССЛЕДОВАНИЙ НА АЛЯСКЕ

Department of Russian Art History . ... Fields of study include the History of Fine Arts (Painting, Sculpture, Graphics) and the History of Decorative Art and Architecture in Russia from the Tenth through the Twentieth Centuries. ... Classical, Romantic and Eclectic Trends in Russian Architecture of the Nineteenth Century; the Search for Style; Comparisons to Architectural Experience of Western Europe . Romantic Tradition in Russian Art of the Nineteenth Century . ...

Еще в разделе: (Показать все результаты (>155) - hist.msu.ru/ )

• Morozov's Social Policy: Nickolskaya Manufacturing (1860s - beginning of the
• Project "The Labour Relations Evolution in Russian Industries"
• Businessmen and Bureaucrats: American Technical Assistance in the Construction

... Guidelines for Paper Submission . ... The program committee will schedule both oral and poster sessions. The abstract and summary of both oral and poster papers are published in the same manner in the Conference Program and the Technical Digest on CD-ROM. ... Oral Sessions . ... Poster Sessions . ... For poster sessions, authors are provided with bulletin boards on which to display their papers, along with a sign indicating their paper numbers, and pushтАУpins or adhesive tape. ... Program . ...

Еще в разделе: (Показать все результаты (>12) - iconolat13.phys.msu.ru/ )

• School
• Registration info
• Program overview

Division Information . ... Site Information . ... Analytical Chemistry Division at the Department of Chemistry, M. V. Lomonosov Moscow State University is the leading Russian center in analytical science and education . ... Division comprises of 5 research laboratories and education lab facilities. ... Postal address: Analytical Chemistry Division, Department of Chemistry, Lomonosov Moscow State University, Leninskie Gory 1, 119899 Moscow, Russia . ... Chemistry Department of Moscow State Univesity . ...

Еще в разделе: (Показать все результаты (>15) - analyt.chem.msu.ru/ )

. Deprecated : mysql_connect(): The mysql extension is deprecated and will be removed in the future: use mysqli or PDO instead in /wcmc/lms/lms/includes/database.mysql.inc on line 31 . Warning : mysql_connect(): Can't assign requested address in /wcmc/lms/lms/includes/database.mysql.inc on line 31 . Can't assign requested address

79. Master program "Enterprise Information Systems" | Магистерское и послевузовское

80. Textbooks - Dynamic Processes in Geology