Выберите категорию обращения: Общие вопросы Отчеты Рейтинги Диссертационные советы Конкурсы Ввод данных Структура организаций Пользователи Проблемы с регистрацией\входом в систему . ... Войти в систему . ... Troitsky S.V. , Troitsky V.E. в журнале Physical Review D - Particles, Fields, Gravitation and Cosmology , издательство American Physical Society (United States) , том 91, ? ... Frere J.M. , Libanov M.V. , Nugaev E.Y. , Troitsky Sergey V. в журнале JHEP , том 306, с. 009 . ...

Еще в разделе: (Показать все результаты (>6206) - istina.msu.ru/ )

• Physical Review B - Condensed Matter and Materials Physics - журнал | ИСТИНА -
• Physical Chemistry Chemical Physics - журнал | ИСТИНА - Интеллектуальная
• Rasing Theo - сотрудник | ИСТИНА - Интеллектуальная Система Тематического

О лаборатории . ... Лаборатория теоретической биофизики . ... OPLS-AA topology generation is a very complex task because of huge amount of the atomtypes described this force field. ... We use OPLS-AA with some includings; ?includings? are overlays on the standart GROMACS forcefield files. ... All-atom automatic OPLS-AA topology generator . ... comcon1 in All-atom automatic OPLS-AA topology? . ... OPLS-AA? in All-atom automatic OPLS-AA topology? ... 2011 ERG Research Group . ...

Еще в разделе: (Показать все результаты (>42) - erg.biophys.msu.ru/ )

• Nanotubes generating script for PyMol ERG Research Group: Лаборатория

... A t the Faculty of Physics, the undergraduates during first five semesters receive basic education, which includes courses and practicums on general physics, mathematics, programming, and other subjects. ... At this point, the students are assigned to the different chairs, and, along with the general courses they receive some specialized training within the frame of scientific research conducted at the specific chair. ... Offered diploma in Physics and Astronomy . ... Courses on choice (2 courses). ...

Еще в разделе: (Показать все результаты (>36) - foroff.phys.msu.ru/ )

• Postdoctoral training (Neutronography)
• Postdoctoral training of foreign scientists at Physical Department

... Why do I see a string of "X"s (or "N"s) in my query sequence that I did not put there? ... BLAST (Basic Local Alignment Search Tool) is a set of similarity search programs designed to explore all of the available sequence databases regardless of whether the query is protein or DNA. ... Filters are used to remove low-complexity sequence because it can cause artifactual hits (please see Q: After running a search why do I see a string of "X"s (or "N"s) in my query sequence that I did not put there? ...

Еще в разделе: (Показать все результаты (>247) - www.genebee.msu.ru/ )

• GeneBee BLAST 2.2.22+ Services Help
• GeneBee BLAST 2.2.8 Services Help
• BLAST Reference Manual Pages

... Length=2222430 Score = 55.4 bits (60), Expect = 6e-08 Identities = 53/68 (78%), Gaps = 0/68 (0%) Strand=Plus/Plus Query 141 TTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTC 200 || Sbjct 1090874 TTACTGGGCTTAAAGCGCCCGTAGCCGGCCCGGCAAGTCGCTCCTGAAATCCCCGGGCTC 1090933 Query 201 AACCTGGG 208 || ... Sbjct 2071246 AGCCGCGGTAATACGG 2071261 Score = 28.3 bits (30), Expect = 8.9 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Plus Query 222 ACTGGCAAGCTTGAG 236 || ...

Еще в разделе: (Показать все результаты (>16) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast.out
• ConClus

Computer analysis of chromosome contacts obtained by ChIA-PET and Hi-C technologies Ekaterina V. Kulakova, Novosibirsk State University, 630090, Novosibirsk, Russia, 2 Pirogova Str. kylakovaekaterina ... .org Yuriy L. Orlov The Institute of Cytology and Genetics, 630090, Novosibirsk, Russia, Lavrentyeva ave., 10, orlov@bionet.nsc.ru Transcription regulation is a complex yet well-organized process in eukaryotes, in which chromatin ...

Еще в разделе: (Показать все результаты (>302) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/171.pdf
• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/27.pdf
• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/91.pdf

... Инновационная . структура МГУ . ... Обучение инновационному менеджменту . ... Нормативно-правовая база инновационной . деятельности . ... Process of Forming a Company . ... Finance for Start-Up . ... Plan the Company's Future . ... Consider how much differentiation there should be in the company. ... Determine how formal the company will be structured? ... 2005 Управление инновационной политики . и организации инновационной деятельности . МГУ им. М.В. Ломоносова . ...

Еще в разделе: (Показать все результаты (>20) - innovation.msu.ru/ )

Series on Stability, Vibration and Control of Systems, Series A - Vol. ... MULTIPARAMETER STABILITY THEORY WITH MECHANICAL APPLICATIONS . ... This book deals with fundamental problems, concepts, and methods of multiparameter stability theory with applications in mechanics. ... Introduction to Stability Theory . ... Read Full Review . ... Since Bolotin's pioneering book on nonconservation problems on the theory of elastic stability, not many books appeared at such a high level, such as this one. ...

Еще в разделе: (Показать все результаты (>31) - mailybaev.imec.msu.ru/ )

... In vitro, the protein S7 of Thermus thermophilus is able to form complexes with both the minimal 16S rRNA fragment and the intercistronic region of the str operon mRNA from E.coli (Kd = 1.4x10-7 M and 1.1x10-7 M respectively). ... The filter binding assay. ... The most striking result of our study is that thermophilic protein S7 binds strongly to the E.coli S12-S7 intercistronic region of str mRNA in vitro, inspite of the lack of the functionally analogous thermophilic extended region. ...

Еще в разделе: (Показать все результаты (>8) - rnp-group.genebee.msu.ru/ )

• http://rnp-group.genebee.msu.su/pdfs/MolBio6_00KopylovLO.pdf
• http://rnp-group.genebee.msu.su/pdfs/article_vas_bioelectro.pdf
• http://rnp-group.genebee.msu.ru/pages/pdf/biochem2002_1.pdf

... Поступление иностранных граждан . ... Russian Language Program . ... General Russian Courses . Courses of Russian for Specific Purposes . How to Register for a Course and Receive the Entrance Visa . ... The Faculty of Foreign Languages and Area Studies at Moscow State University offers courses of General Russian to learners of all levels from Absolute Beginners through to Advanced. ... If you would like to register for a course please provide us with the following information: . ...

Еще в разделе: (Показать все результаты (>81) - ffl.msu.ru/ )

• About Us

... On the basis of interdisciplinary approach (synthesis + physical experiment + theory + simulation) we aim to develop the new technology for formation of polymer fibers via the elongation of reversible polymer gels in the process of fiber spinning. ... to synthesize new copolymers with associative groups forming reversible gels and to study physical properties of these gels including the behavior in elongational flow; . ...

Еще в разделе: (Показать все результаты (>380) - polly.phys.msu.ru/ )

• SHORT ANNOTATION AND MAIN RESULT
• NATO Scientific & Environmental Affairs
• Seminar in Polymer Physics

The purpose of the space-physics lab exercises is to introduce the students to the methods of the measurements, to the modern conception of near-Earth space structure and the physical processes and phenomena occured in it. ... At present the reasearches and the teachers of the University and of other institutes participating in the project continue development of the the special space-physics lab exercises, and they are interested in your ideas concerning the future exercises. ...

Еще в разделе: (Показать все результаты (>61) - cosmos.msu.ru/ )

... Home > Scientific laboratories > IM . ... The Laboratory of Industrial Mathematics (LIM) headed by Professor V.M. Goloviznin was established in the Faculty of Computational Mathematics and Cybernetics (CMC) of Lomonosov Moscow State University in 2011. ... In the area of energy and space, examples of topical engineering problems LIM is involved in, include the numerical simulation of new-generation atomic plants and computational aeroacoustics. ... Source URL: http://en.cs.msu.ru/laboratories/im . ...

Еще в разделе: (Показать все результаты (>121) - en.cs.msu.ru/ )

• Laboratory of Industrial Mathematics | CMC MSU
• Laboratory of Heat and Mass Transfer Processes Simulation | CMC MSU
• Department of Mathematical Statistics | CMC MSU

THE ALBANIAN AGRICULTURAL SECTOR IN TRANSITION . ... I. DEVELOPING A MARKET ORIENTED ECONOMY AS MEANS FOR SECURING THE SURVIVAL OF FARMERS . The transition from a centralized economy to a free market economy has become a reality and has created the circumstances for market development. Albania's agri?industrial trade strategy is to fully adapt to a free market economy for both domestic products and commodities, as well as for imports and exports. ... OF AGRICULTURE IN A MARKET ECONOMY . ...

Еще в разделе: (Показать все результаты (>168) - www.fadr.msu.ru/ )

• Commission Report of the Inter-Congress period 1999-2003
• SCENARIOS FOR INTEGRATION
• NAP NEWSLETTER N. 1

CO2 ­ - .. E-mail: : Zavalov_Yuri@yahoo.com The effect of isobaric enhancement of temperature fluctuation amplitude under volumenonuniform heat generation in the turbulent flow of CO2 laser active medium has been investigated for pulse-periodic mode of energy input. ... Zavalov Yu.N., Galushkin M.G., Grishaev R.V., Golubev V.S., Dubrov V.D. The Development of Turbulence in the Active Medium of a Fast-Flow Gas-Discharge Laser // Laser Physics, vol. ...

Еще в разделе: (Показать все результаты (>222) - nuclphys.sinp.msu.ru/ )

• http://nuclphys.sinp.msu.ru/news/kamland/KamLAND_PRL.pdf
• http://nuclphys.sinp.msu.ru/conf/XFEL/XFEL-TDR_Chapter09_Project%20Management.pdf
• http://nuclphys.sinp.msu.ru/nseminar/antares_nemo.pdf

Theoretical problems of electrical double layer structure on ideally polarizable electrodes and reversible adsorption of ions and neutral organic molecules on electrodes are considered, and also the specific features of kinetics of multistep electrochemical processes limited by mass transfer, electron transfer and chemical reaction. Special attention is paid to computer simulation of specific adsorption and coadsorption of ions and neutral organic molecules on the electrode surfaces. ...

Еще в разделе: (Показать все результаты (>102) - electr003.chem.msu.ru/ )

• Victor A. Safonov:CV
• Maria A. Choba: Selected Publications

... Publications . ... SPDC Laboratory . Quantum Electronics Chair . ... Generation of Polarization Entangled States in Spatially Inhomogeneous Ferroelectrics?, Advanced Science Letters, 2 (4), 430?447 (2009). ... Download [ help ]: . ... Copyright notice: This material is presented to ensure timely dissemination of scholarly and technical work. ... All persons copying this information are expected to adhere to the terms and constraints invoked by each author's copyright. ...

Еще в разделе: (Показать все результаты (>131) - qi.phys.msu.ru/ )

• Directions :: Quantum Information Laboratory
• Sergei Kulik: Scientific interest

... 20.09.2009 . ... Moscow Vyatichi, November 9 - 11, 2009. ... In this work we study sum-frequency generation from the surface of an isotropic chiral medium in arbitrary interaction geometry of the paraxial light beams at fundamental frequencies. ... Within the first-order approximation approach, generally, the polarization state of light is distributed inhomogeneously in the reflected signal beam cross section, and the transversal intensity distribution is not Gaussian. ... Full publication text . ...

Еще в разделе: (Показать все результаты (>788) - ofvp.phys.msu.ru/ )

• Публикация
• Laboratory of nonlinear polarization optics
• Laboratory of solid-state lasers and coherent spectroscopy

... - behave-, believe-, blurred-, body- border- both-; ... , ... bottom-, bursary- but-, , ; ; , calculate-, capable-, , carry-, ~ away - ~out- Cartesian- case-, cause-; cathode- centre- 4 certainly-, champion- (- ), , , change-, , characterise-() characteristic-, ... weight- whereas- while-, whole-, wide-, , width- witness-, wonder- no ~ - worth- to be ~ doing smth- - Y yield- Z zinc- 35 ...

Еще в разделе: (Показать все результаты (>22) - www.eng.math.msu.su/ )

• http://www.eng.math.msu.su/download/plan.pdf
• http://www.eng.math.msu.su/download/Midterm_test.pdf

... About lab . ... Online Journal "Computer graphics and multimedia" (in russian) . ... dealing with fuzzy edges . ... Some pixels of source image may be a mixture of background and foreground due to . ... Solution: use Matting to decompose source image to background image, foreground image and transparency map . When extrapolating new views source images don't contain all necessary information to fill occlusions on edges of depth map . ... use current frame to generate missing information . ...

Еще в разделе: (Показать все результаты (>221) - graphics.cs.msu.ru/ )

• GML LidarK Library | Graphics and Media Lab
• High quality stereo-to-multiview generation | Лаборатория компьютерной графики
• GML LidarK Library | Лаборатория компьютерной графики и мультимедиа