... For the past years I have been working on the problem of synthesis of light curves of close binary systems, consisting of a normal star and a compact object (point object with fixed X-ray luminosity). ... Possible existence of a bright spot on the disk's lateral surface is taken into account. ... The last of then will be published in Gordon and Breach Publishers ( Cherepashchuk A.M., Katysheva N.A., Khruzina T.S., Shugarov S.Yu. ... Cherepashchuk A.M., Katysheva N.A., Khruzina T.S., Shugarov S.Yu. ...

Еще в разделе: (Показать все результаты (>12) - uranus.sai.msu.ru/ )

• MERLAN
• Anatol Cherepashchuk
• Igor Antokhin

Alexander Kryukov kryukov at theory.sinp.msu.ru . ... Previous message: [Comphep-common] [Fwd: Re: problems with compHEP (Cross- Section)] . ... Dear Alex! Unfortunately, we do not support CompHEP for M$ Windows. ... You can take it from the official Web site: http://theory.sinp.msu.ru/comphep Regards, A.Kryukov On Fri, 2004-04-23 at 16:46, Alex B. Flanchik wrote: > Dear A. P. Kryukov! ... How big > variable COMPHEP could be? ... Alexander Kryukov < kryukov at theory.sinp.msu.ru > SINP MSU . ...

Еще в разделе: (Показать все результаты (>1963) - theory.sinp.msu.ru/ )

• [Comphep-common] [Fwd: Re: problems with compHEP (Cross- Section)]
• Install
• [Comphep-common] Fwd: Re: [Comphep-devel] Fwd: Re: CompHep Installation on 64

The preliminary program . of the International Congress . Russian Language: . ... Problems of historical Russian linguistics within Common Slavic and Indo-European context: inheritance, development, cultural contacts. ... Dynamic picture of modern Russian language synchrony . ... Stable features of modern Russian public language: factors and tendencies of the development of its means and genres. ... New features and aspects of Russian fiction language of the end of XX-th century research. ...

Еще в разделе: (Показать все результаты (>345) - www.philol.msu.ru/ )

• Sample linguistic problems :: МГУ :: Филфак :: ОТиПЛ

... Master Education . ... Master programs . ... Master program "Mathematical Models of Complex Systems: Theory, Algorithms, Applications" . ... The Mathematical Models of Complex Systems: Theory, Algorithms and Applications Master?s programme is aimed at studying the foundations of computational methods and software for new types of current problems in modelling, decision-making, and control of complex systems. ... Второе высшее образование: second_edu@cs.msu.ru, 6-й этаж, комната 640, тел. ...

Еще в разделе: (Показать все результаты (>130) - hcs.cmc.msu.ru/ )

• Master programљ"Decision Engineering in Economics and Finance" | Магистерское и
• Master program "Information Security and Cryptography" | Магистерское и
• Master program "Enterprise Information Systems" | Магистерское и послевузовское

FemtoScan 001 - FAQ . Russian version . ... How to build a histogram for a part of image . ... How to copy and print files seen in Quick View . Quick View Parameters and other options . About Macros . ... Choose the command Parameters in the menu View or in the popup menu, which appears after pressing the right button of the Mouse. ... All the images seen in Quick View . ... QuickView] - Legend view, seen on the images of Quick View , number of images ( Show All Images ) . ...

Еще в разделе: (Показать все результаты (>149) - www.spm.genebee.msu.ru/ )

• DSP bard program downloading

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>23) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... One of the project objectives was to investigate practical efficiency of some modern iterative methods, including multigrid techniques and domain decomposition methods as well as methods for small compressible materials. ... Hence, the project research initiated because of INTAS financial support contributes in setting up modern computational techniques in tire design. ... Research on efficiency of iterative methods was conducted at the department of Mechanics of Composites about ten years ago. ...

Еще в разделе: (Показать все результаты (>4) - composite.msu.ru/ )

Department of Russian Art History . ... Fields of study include the History of Fine Arts (Painting, Sculpture, Graphics) and the History of Decorative Art and Architecture in Russia from the Tenth through the Twentieth Centuries. ... Classical, Romantic and Eclectic Trends in Russian Architecture of the Nineteenth Century; the Search for Style; Comparisons to Architectural Experience of Western Europe . Romantic Tradition in Russian Art of the Nineteenth Century . ...

Еще в разделе: (Показать все результаты (>211) - hist.msu.ru/ )

• The Center for Theoretical Problems in the Historical Sciences
• Centralized Resource Allocation in the Soviet Economy in the 1930's
• Russia and Western Countries: Economic Relations Before World War I and the

... Commission on Paleopedology . ... THE FIRST SCIENTIFIC DESCRIPTION OF EUROPEAN LOESS-PALEOSOL SEQUENCES - Alexander Makeev 08/3/2006 ( 0) . ... paleosol] Re: PalaeoPedology as a Commission - Dr.Stephen Nortcliff 27/11/2003 ( 0) . paleosol] Re: PalaeoPedology as a Commission - dan yaalon 26/11/2003 ( 0) . paleosol] Re: The future of the Paleopedogy Commission - Mermut 28/9/2003 ( 0) . ... Definition of paleosol and geosol; memo to John Catt - Roger Morrison 10/10/99 ( 1) . ...

Еще в разделе: (Показать все результаты (>3) - www.paleopedology.msu.ru/ )

1, 120101 (2012) : . 119991, , , . ... Alternative core environmental mo dule for students : features of the foundations of ecology from the physics p ositions V. A. Gordienko 1 1,a , K. V. Pokazeev 2,b , M. V. Starkova 3,c 3 M. V. Lomonosov Moscow State University, Physical Faculty, Department of Acoustics. ... Keywords : ecology and environmental management, environmental education, a systematic approach to the ecology and current environmental problems, modeling and prediction in ecology. ...

Еще в разделе: (Показать все результаты (>2) - uzmu.phys.msu.ru/ )

... MSU Graphics & Media Lab (Video Group) . It is a free AviSynth filter for fixing situation when odd and even lines of source frame are placed in alternate output frames and other similar problems. ... If this position exists, optimal odd lines are placed into the current frame, otherwise (for example when odd lines field is located in one frame after even lines, and we are in the last frame) the odd field is interpolated, or no changes are done (behavior depends on filter's settings). ...

Еще в разделе: (Показать все результаты (>816) - graphics.cs.msu.ru/ )

• Saliency Map Estimation | Graphics and Media Lab
• Keyframe-based Depth Compression | Graphics and Media Lab
• Keyframe-based Depth Compression (Update) | Graphics and Media Lab

... Davis Center for Russian Studies at Harvard University. The Center aims at developing of fundamental knowledge about Russia, its culture, and its institutions. The Center also examines Russia in its regional and historical context, and welcomes and supports the study of neighboring countries that have been either integrated with, or subordinated to, the Russian state at various periods in history, or whose experience poses intellectual problems similar to those of Russia. ...

Еще в разделе: (Показать все результаты (>33) - suny.msu.ru/ )

... MSU Web Sites . ... Study and Research . ... 119992,Russian Federation, Moscow, MSU, Lenin Hills 1-51, 7-th floor, room 752, Higher school of modern social sciences . ... The Higher School of Modern Social Sciences (faculty) (VSHSSN) was established in 2006. ... Central disciplines include Sociology of knowledge, Economy of knowledge, Social management, Social control, State audit, Translation of the professional text. ... Sociology of management . ... Social sciences (Sociology of management). ...

Еще в разделе: (Показать все результаты (>133) - www.msu.ru/ )

• THE FACULTY OF POLITICAL SCIENCE

... IPI-1D is a set of programs for processing and interpretation of VES data within the framework of horizontally layered models . ... Except programs already listed above, our specialists developed some programs for modeling, studying, visualization and interpretation of resistivity data in anisotropic media (anisotropic halfspace, horizontally layered media with anisotropic basement and vertical contact of two anisotropic media). ...

Еще в разделе: (Показать все результаты (>68) - geophys.geol.msu.ru/ )

• Anis. Page2
• Software for resistivity and induced polarization
• Support

Studying at MU Programs and degrees . ... Moscow State University provides a wide range educational services and educational programmes. ... International students are offered Bachelour (4 years full time) and Master programmes (2 years full time). A number of our faculties train both domestic and international students according to Bachelour and Master programmes with granting Bachelour and Master diplomas. ... Please, contact International Students Office for information on the topics offered. ...

Еще в разделе: (Показать все результаты (>7) - www.ied.msu.ru/ )

... Commission on Paleopedology . ... THE FIRST SCIENTIFIC DESCRIPTION OF EUROPEAN LOESS-PALEOSOL SEQUENCES - Alexander Makeev 08/3/2006 ( 0) . ... paleosol] Re: PalaeoPedology as a Commission - Dr.Stephen Nortcliff 27/11/2003 ( 0) . paleosol] Re: PalaeoPedology as a Commission - dan yaalon 26/11/2003 ( 0) . paleosol] Re: The future of the Paleopedogy Commission - Mermut 28/9/2003 ( 0) . ... Definition of paleosol and geosol; memo to John Catt - Roger Morrison 10/10/99 ( 1) . ...

Еще в разделе: (Показать все результаты (>150) - www.fadr.msu.ru/ )

• SOILS, PALEOSOLS, AND GEOSOLS: A Commentary
• Contens
• Created with DiDa

... Fortran GNS Language . ... The system RAMPA is designed to create, debug and monitor parallel programs for MIMD distributed-memory machines. ... The system will also allow the development of programs with Fortran GNS, Fortran 77 and C languages, extended with tools from specially made library for parallel programs support. ... Above that, using the instrumental computer for debugging could help a programmer to rewrite his sequential program into parallel one written in Fortran DVM language. ...

Еще в разделе: (Показать все результаты (>142) - sp.cs.msu.ru/ )

• Performance of DVM-programs
• Explicit cyclic schemes for space neutron kinetics in (Hex-Z) geometry
• DVM-system. Installation guide. Version 3.30

Astronomy Picture of the Day . An Airglow Fan from Lake to Sky . ... 27.01.2016 . ... Credit Copyright: Dave Lane ; Rollover Annotation: Judy Schmidt Explanation: Why would the sky look like a giant fan? Airglow . ... The unusual pattern was created by atmospheric gravity waves , ripples of alternating air pressure that can grow with height as the air thins, in this case about 90 kilometers up . ... January . ... January 2016 . ... NASA Web Site Statements, Warnings, and Disclaimers . ...

Еще в разделе: (Показать все результаты (>6168) - www.astronet.ru/ )

• Journal "Peremennye Zvezdy"
• Астронет > Unusual Layers on Saturns Moon Phoebe
• Астронет > Семинары на 05 ноября 2003 > Астрономия.

... This contribution investigates the finite amplitude standing wave generated in a closed pipe by a transient source when its instantaneous frequency varies and successively meets a set of resonance frequencies. ... Based on the well known nonlinear Burgers equation governing nonlinear propagation in viscous media, a new updated incident wave schema is developed and its efficiency to compute the nonlinear resonance modes of a closed tube is demonstrated. ...

Еще в разделе: (Показать все результаты (>176) - acs366.phys.msu.su/ )

... Scientific directions . ... The research of the department of General Problems of Control has taken four major directions, each of which has several branches. ... general Lagrange principle, problems of convex analysis and methods of duality in the theory of extremal problems . ... free-boundary problems . ... Optimization, optimal control, numerical methods and questions of applied mathematics: . ... 119992 Moscow, GSP-1, Leninskie Gory, MSU, mechanics and mathematics department, OPU, Room 13-14 . ...

Еще в разделе: (Показать все результаты (>118) - new.math.msu.su/ )

• Seminars of the department | Department: General Problems of Control. Faculty
• Current staff list | Department: General Problems of Control. Faculty of
• Extra courses of the department | Department: General Problems of Control.