Natural Satellites Data Center NSDC . ... Natural Satellites Ephemerides Server MULTI-SAT. ... OF NATURAL PLANETARY SATELLITES. ... A light movement of your arm ... and all necessary data are instantly available on your computer screen. ... New orbital models for all the new faint satellites of Jupiter, Saturn, Uranus and Neptune were determined independently from other authors on the basis of all published observations using numerical integration method applied to the equations of satellites motions. ...

Еще в разделе: (Показать все результаты (>213) - lnfm1.sai.msu.ru/ )

• Data bases of Natural Satellites. Documentation. Structure

. [ Войти ] . Главная -> Фильмы -> Occasional Coarse Language . Пользователи . Демо . Деньги . Фильмы . Форум . Occasional Coarse Language . Австралия 1998 . отметить . Мелодрама . Комедия .

Еще в разделе: (Показать все результаты (>143) - kinfo.ru/ )

• Mind Your Language - Фильмы - Kinfo.ru
• English as a Second Language - Фильмы - Kinfo.ru
• Body Language - Фильмы - Kinfo.ru

Skip to main content . ... Факультет биоинженерии и биоинформатики Московского Государственного Университета имени М. В. Ломоносова открывает экспериментальный набор на обучение по программе повышения квалификации ? Исследование природы вместе с детьми ?. Обучение платное, стоимость ? ... Программа ?ИССЛЕДОВАНИЕ ПРИРОДЫ ВМЕСТЕ С ДЕТЬМИ? предназначена для повышения квалификации педагогов и родителей, заинтересованных в привлечении детей к исследованию природы. ... Ученые ? детям ? ...

Еще в разделе: (Показать все результаты (>1636) - www.kids.genebee.msu.ru/ )

... Information for foreign students . ... Foreign Language . The Head of the Chair, Associate Professor T.Yu.Safyannikova The Foreign Language Chair of the Faculty of Geology of MSU was established in 1998. It replaced the former English Language Chair. ... Associate Professor N.G.Kitkova at the exam The Chair maintains close contacts with language departments of other institutes of higher education in Russia as well as with a number of universities in the USA, Great Britain and the Netherlands. ...

Еще в разделе: (Показать все результаты (>80) - www.geol.msu.ru/ )

• Faculty of geology Moscow State Lomonosov University

... Fast Facts about the Faculty of Journalism . ... Academic Departments . ... Partners . ... All partners . ... The Department of Russian Language Stylistics was established in 1952.  ... Since 1998, the department is headed by Professor Grigory Solganik. ... The department publishes an academic journal Journalism and Culture of Russian Speech. In 2012, the department published a few collective monographs: Language of Mass Media and Politics. ... Language of Newspapers, Radio and Television. ...

Еще в разделе: (Показать все результаты (>44) - www.journ.msu.ru/ )

... Please be careful while filling the information. All fields labeled with * must be filled. Be careful writing the second name and e-mail address. The procedure of login/password recovery will be impossible without exact spelling of these fields. If you can be available as a reviewer, please turn on the button in the appropriate section. First name . Second name . ... E-mail address . ... Available as a reviewer? ... Enter preffered user name . ...

Еще в разделе: (Показать все результаты (>5437) - zmmu.msu.ru/ )

• Types Database

The department was founded in 1967. The department was headed by Candidate of Pedagogics, Assistant Professor N.M. Golovkova (1967-1981), Candidate of Philology, Assistant Professor G.N. Agapova. Since 1993 the department has been headed by Candidate of Pedagogics, Assistant Professor Margarita Mikhailovna KUTEPOVA . ... The major field of research of the department are linguistic study of the chemical terminology and development of the most perspective methods of English language teaching. ...

Еще в разделе: (Показать все результаты (>451) - chem.msu.ru/ )

THE LANGUAGE OF A. PLATONOV . ... Alexei Petrovich Tsvetkov . A dissertation submitted in partial fulfillment of the requirements for the degree of . Doctor of Philosophy (Slavic Languages and Literatures) in The University of Michigan 1983 . Doctoral Committee: . Professor Vitalij Shevoroshkin, Chairman Professor Assya Humesky Professor Roman Szporluk Professor Irwin Titunik . ... 1983 . ... Профессор Б.В.Шеворошкин, председатель . Профессор Ася Гумецкая . ...

Еще в разделе: (Показать все результаты (>12) - uni-persona.srcc.msu.ru/ )

. Rus / Eng . 0 . 2013 . Impact Factor . Log In or Register . Main . Staff . Publications . Journals . Conferences . Contacts . Main . Staff . Publications . Journals . Conferences . Contacts . Back to the list . Language Editor of the journal Regular and Chaotic Dynamics . Universitetskaya, 1, Izhevsk, 426034, Russia . valiulin@rcd.ru . Main . Staff . Publications . Journals . Conferences . Contacts . Institute of Computer Science Izhevsk, 2005 - 2016 .

Еще в разделе: (Показать все результаты (>218) - ics.org.ru/ )

• Institute of Computer Sciences - Publications
• Institute of Computer Sciences - Staff

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>23) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

Ссылки для изучения студентам, предполагающим делать курсовую работу в группе Плетнева . ... http://rcs.chph.ras.ru/ . http://www.doktor.ru/doctor/biometr/ . http://www.nsu.ru/ef/tsy/ecmr/index.htm . NIST Statistics Handbook http://www.itl.nist.gov/div898/handbook/ . ... Statistica for Windows http://www.statsoft.ru/home and www.statsoft.com . Python programming language http://www.python.org . Cambridge Crystallographic Database http://www.ccdc.cam.ac.uk . ...

Еще в разделе: (Показать все результаты (>17) - analyt.chem.msu.ru/ )

pic] The Ministry of Education of the Russian Federation The Scientific and Methodological Council on Foreign Language Teaching The (Russian) National Association of Applied Linguistics (NAAL) The Faculty of Foreign Languages and Area studies of Lomonosov Moscow State University DECent - The Distance Education Centre Dear colleagues, You are invited to participate in the 2nd International Scientific and Methodological ... Teaching and learning a foreign language at a distance. ...

Еще в разделе: (Показать все результаты (>8) - dist.ffl.msu.ru/ )

• Факультет иностранных языков МГУ. Центр дистанционного обучения.
• Факультет иностранных языков и регионоведения МГУ. Центр дистанционного