... Research . ... Staff . ... PhD . ... Head of Laboratory, . Professor, Doctor (chem. sci.) ... PhD, senior researcher . ... Dr. (tech. sci.), prinsipalљresearcher . ... PhD, juniorљresearcher . ... Dr. (tech. sci.), principalљresearcher . ... PhD, principalљresearcher . ... Dr. (chem. sci.), principalљresearcher . ... Colloquium on 24.12.12 20 Dec 2012 . ... Colloquium on 23.11.12 22 Nov 2012 . ... Laboratory of Chemical Thermodynamics . ... 2000-2016 Laboratory of Chemical Thermodynamics . ...

Еще в разделе: (Показать все результаты (>92) - td.chem.msu.ru/ )

• Colloquium on 09.11.12 Laboratory of Chemical Thermodynamics
• PhDi Laboratory of Chemical Thermodynamics
• Colloquium on 28.04.11 Laboratory of Chemical Thermodynamics

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>23) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search
• ConClus

Moscow State University . INTERNATIONAL CONFERENCE . ... Moscow, Russia . ... Institute of Mechanics of MSU . ... The aim of this Conference is gathering active researchers and students in the field of nonlinear fluid dynamics in order to provide a forum for discussions. Since 1976 through 2008 the Conference was organized by the Institute of Mechanics of Moscow State University (see http://hit2003.narod.ru/ ). ... Institute of Mechanics , Moscow State University . ...

Еще в разделе: (Показать все результаты (>38) - hit-conf.imec.msu.ru/ )

... Submit your article . ... The article examines the problems of regional social and demographic management is. ... The author proposes a methodology for assessment of efficiency of the regional social and demographic management. The methodology allows to substantiate specific directions of investment. ... Social and demographic processes, management efficiency, social and demographic transformations and anomalies, socially significant budget items, indicative analysis. ... Public Administrarion". ...

Еще в разделе: (Показать все результаты (>425) - ee-journal.spa.msu.ru/ )

... But we try to focused on the most actual and modern subjects, mainly in theoretical astrophysics. Chief problem is internal structure of the Sun. The structure of turbulent convection region and its influence on acoustic spectrum . ... Mathematical aspects of a problem of standard solar model construction . The role of opacity and EOS in solar structure . Model with given sound speed profile . Neutrino problem - model approach . High presice intergation of solar model . ...

Еще в разделе: (Показать все результаты (>4570) - crydee.sai.msu.ru/ )

• Work notes
• Heliophysics, Internal structure and seismology
• crydee.sai.msu.ru archive : search

... Data and place of birth: . ... Excitation of nuclear and hadron degree of freedom in hadron-nucleus interaction . ... Participation in experiments: . The theoretical calculation and the analysis of data in experiment of ITEP (Moscow,1972-1978) on the Rho-meson production by pions at 3.72 Gev/c on nuclear target . ... The analysis of data in SMS MSU experiment (Dubna, 1985-1990) devoted to the space-time structure of hadron interaction in proton- nucleus collisions at 9 GeV/c (JINR accelerator) . ...

Еще в разделе: (Показать все результаты (>68) - lav01.sinp.msu.ru/ )

• Title and CV of Olga Kodolova

... Laboratory of Problems for Magnetism, . ... Study of the magnetic and transport properties of R-3d intermetallic compounds with a magnetic instability of the itinerant-electron subsystem. ... const at high temperatures (Curie-Weiss law) [A.S. Markosyan, Y. Hosokoshi, K. Inoue, Phys. Lett. ... Gaidukova, Y. Hosokoshi, K. Inoue, A.S. Markosyan , Magnetic phase diagram and pressure effect on the magnetic properties of the Y 1? x Gd x Mn 2 intermetallic compounds, J. Phys.: Condens. ...

Еще в разделе: (Показать все результаты (>29) - ferro.phys.msu.ru/ )

• http://ferro.phys.msu.ru/lab6/eng/dubenko.htm
• Physics Faculty of Moscow State University.
• Laboratory of Rare Earth Intermetallics

Databases (NSDC) of the Natural Planetary Satellites. ... NSDC: Database of astrometric observations of Natural Planetary Satellites . ... They are thoroughly looking for observations in different sources, creating their owndatabases which are then mostly inaccessible to other researchers. ... In the file "content" with explications, the reference is given to the data source as well as the bibliographic reference. ... Data sources. ... Why a specific bibliographic database for Natural satellites? ...

Еще в разделе: (Показать все результаты (>393) - lnfm1.sai.msu.ru/ )

• Scientific activity
• Marat Abubekerov - Curriculum Vitae
• Popular and useful searches in NASA ADS

... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . ... Аналитик Executive Search . ... Egon Zehnder International, a leading global Executive Search Firm is looking for a Researcher . ... Re: Аналитик Executive Search [ re: Daria ] ....

Еще в разделе: (Показать все результаты (>5666) - www.fds-net.ru/ )

• что-то не так (resolv search) - Public forum of MSU united student networks
• Chemists, Attention! Search on databases! - Public forum of MSU united student
• Fast SMB Search on SourceForge - Public forum of MSU united student networks

Chair of General Physics and Wave Processes, Physics Faculty of MSU . Main . ... Science and education . ... Head of chair . ... Science . ... Education . 20.09.2009 . 3-d International Laser Graduate School "Modern Problems of Laser Physics LGS-2009 " . Moscow Vyatichi, November 9 - 11, 2009. ... Laboratory of laser biomedical photonics . ... Publications . ... 2009 ILC MSU Made in: Sebekon IT Solutions . 2009 Chair of GP and WP, physical department Made in: Sebekon IT Solutions . ...

Еще в разделе: (Показать все результаты (>859) - ofvp.phys.msu.ru/ )

• Laboratory of solid-state lasers and coherent spectroscopy
• Laboratory of superstrong laser fields
• Laboratory of Terahertz Optoelectronics and Spectroscopy

... PHP 4 ) yaz_search -- Prepares for a search . int yaz_search ( int id, string type, string query) . ... and query1 query2 . ... or query1 query2 . ... set name . ... attr set type=value query . ... computer matches documents where "computer" occur. ... attr 1=4 art attribute type is 1 (Bib-1 use), attribute value is 4 Title), so this should match documents where art occur in the title. ... The query matches documents where art occur in the title and in which donald knuth occur in the author. ...

Еще в разделе: (Показать все результаты (>435) - oit.cmc.msu.ru/ )

• ldap_search
• udm_set_agent_param
• array_search

... Geography of World Economy . ... Recreational Geography and International Tourism . ... Physical Geography and Landscape Science . ... search | ... About Faculty . ... Research laboratories . ... Type of field courses . ... all) Дистанционное обучение Questions VIpuskniki Grants catalog Diss catalog laureat Publications News Forum Photogalery . ... International programme in Natural Resource Management and Law offers a unique combination of Natural and Environmental Sciences and Science of Law. ...

Еще в разделе: (Показать все результаты (>110) - eng.geogr.msu.ru/ )

• International cooperation
• Department of Cryolithology and Glaciology
• Renewable Energy Sources

... About lab . ... The LidarK library provides an open-source framework for processing multidimensional point data such as 3D LIDAR scans. ... Download LidarK 2.0 , or browse for the previous versions and data samples . ... We called the data structure we designed Seg-Tree . ... GML LidarK Library v. 2.0 September 10, 2010 Download . GML LidarK Library v. 1.2 December 5, 2008 Download . GML LidarK Library v. 1.1 September 9,2008 Download . GML LidarK Library v. 1.0 July 1, 2008 Download . ...

Еще в разделе: (Показать все результаты (>883) - graphics.cs.msu.ru/ )

• VQMT3D Project | Graphics and Media Lab
• Congratulations to Olga Senyukova and Mikhail Erofeev who have received MSU
• VQMT3D Project | Лаборатория компьютерной графики и мультимедиа

... Snecma Moteurs (Groupe Snecma, France) . ... The Colloquium-458, organized by EUROMECH , will take place at Institute of Mechanics of Lomonosov Moscow State University (MSU) . ... The subjects of the Colloquium-458 cover important problems dealing with the verification of constitutive equations, the organization of experiments, the connection between microstructures and mechanical properties and the effective utilization of the modern FEM packages. ... France. ... S.-Petersburg State Techn. ...

Еще в разделе: (Показать все результаты (>3) - www.imec.msu.ru/ )

International Laser Center of MSU . Home . ... Education . ... Booklet about ILC MSU . ... 06.10.2014 . October 10, 2014 . 15:00 S.A. Akhmanov Hall, KNO . ... 20.09.2009 . 3-d International Laser Graduate School "Modern Problems of Laser Physics LGS-2009 " . Moscow Vyatichi, November 9 - 11, 2009. ... March 21, 2014 . 15:00 S.A. Akhmanov Hall, Nonlinear Optics Bld. ... Home About ILC MSU Staff Priezhev Alexandr V. avp2@mail.ru . ... 2009 ILC MSU Made in: Sebekon IT Solutions . ...

Еще в разделе: (Показать все результаты (>771) - ilc.phys.msu.ru/ )

• Laboratory of nonlinear polarization optics

... Interdepartamental Centre on Agri-Food-Environmental Policy . ... phone: (39) 577 298631 / fax: (39) 577 298661 . E-Mail: tarditi@unisi.it . Representing the researchers outside the CEEC region . ... Russian Academy of Agricultural Sciences . ... Representing academic institutions of the CEEC region . ... Representing the CEEC governmental and non-governmental institutions . ... Research Institute of Agricultural Economics (RIAE) . ... Agriculture and Economic Development . ...

Еще в разделе: (Показать все результаты (>251) - www.fadr.msu.ru/ )

• Untitled
• Commission Report of the Inter-Congress period 1999-2003

Open Conference Systems . ... Conference Content Search . All Authors Title Abstract Index terms Full Text . ... January February March April May June July August September October November December 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 0 . ... By default only papers containing all terms in the query are returned (i.e., AND is implied) . Combine multiple words with OR to find papers containing either term; e.g., education OR research . ...

Еще в разделе: (Показать все результаты (>153) - hea.phys.msu.su/ )

Alexander P. Seyranian . Institute of Mechanics , . Moscow State Lomonosov University , . ... Phone: (7495) 939 2039 . Fax: (7495) 939 0165, 939 2065 . ... My field of specialization are Stability Theory, Parametric Resonance, Gyroscopic Stabilization, Mechanics of Solids, Structural Optimization, Singularities and Bifurcations. ... Technical University of Denmark . Aalborg University, Denmark . ... Institute of Engineering Mechanics and Systems, University of Tsukuba, Japan . ...

Еще в разделе: (Показать все результаты (>4) - seyranian.imec.msu.ru/ )

• Curriculum Vitae of Prof. Alexander P. Seyranian

. Search Engines . about laboratory | staff | administration | research | education | news | search | links | text only . Copyright 2001, Laboratory of Catalysis and Gas Electrochemistry, Web-design A.N. Kharlanov. If you have any questions or cannot find the information you need, mail to webmaster . Last updated 20 April 2001 .

Еще в разделе: (Показать все результаты (>57) - www.kge.msu.ru/ )

• Search Catalogues
• Search in Internet
• Staff Web-pages

... I.N.Modin. ... Pervago E.V., Bobachev A.A., Modin I.N., Shevnin V.A. Report, presented at Annual SAGEEP conference, April 1995, Orlando, Florida, USA. 1 p. RESISTIVITY PROSPECTING IN URBAN REGIONS . ... Bobatchev A.A., Modin I.N., Pervago E.V., Sapognikov B.G., Shevnin V.A. Resistivity method, old and new . ... Volkov S.I., Kolarov D.L., Modin I.N., Muller A., Pervago E.V. Experience of aquatorial electrical survey at Brandenburg land in Germany. 3rd Meeting environmental and engineering geophysics....

Еще в разделе: (Показать все результаты (>105) - www.geol.msu.ru/ )

• Near-surface electrical prospecting laboratory at Moscow University
• Department of Lithology and Marine Geology - Laboratories
• Faculty of Geology >> Departments