... ZOO is a flexible and powerful content application builder to manage your content. ... ZOO moves from simply being a CCK to an Application Builder. Apps are extensions for ZOO which are optimized for different purposes and types of content catalogs. ... A flexible and powerful content application builder to manage your content. Download ZOO . ... escort beylikduzu bayan escort escort bayan escort escort istanbul escort bayan porno film escort istanbul escort beylikduzu escort bayan ...

Еще в разделе: (Показать все результаты (>17) - physcontrol.phys.msu.ru/ )

• Icons
• List All Categories

List of available DNA-protein and RNA-protein complexes . List of Pfam domains presented in DNA-protein and RNA-protein complexes . List of SCOP domains presented in DNA-protein and RNA-protein complexes . ... Amino acid code changer : 3-letter code to 1-letter code and vice versa . The work is supported by the Russian Foundation of Basic Research, grants 06-07-89143 and 06-04-49558, and INTAS, grant 05-1000008-8028 ...

Еще в разделе: (Показать все результаты (>5502) - monkey.belozersky.msu.ru/ )

• DNA/RNA-Protein structures
• Hydrophobic clusters
• About this project

... Graduate student, School of Public Administration, Lomonosov Moscow State University. ... The purpose of this article is to analyze the creation of the Bryansk search station in 1909 in the context of political police reform in the Russian Empire. The author considers special conditions of political police activity in Bryansk district, explores the reasons for creating a search station, evaluates the role of Central Regional Secret Political Police Department. ... Public Administrarion". ...

Еще в разделе: (Показать все результаты (>265) - ee-journal.spa.msu.ru/ )

... Given package is a set of special commands and their handler - JOB program. The command aimed for description of often performed operations with files of PC-GAMESS program (dat, out, pun). ... Commands allow running calculation, performing other programs, data change between files and modification of files. ... Command inserts specified group in file.inp. ... del_g h2o.dat |Command deletes all repetition of| |$basis |specified group in file.inp. ... Command changes contents of group on specified | ...

Еще в разделе: (Показать все результаты (>74) - classic.chem.msu.su/ )

• How to run Firefly under Linux?
• Firefly DOCUMENTATION - command line arguments
• Firefly Documentation

... M.V.Lomonosov Moscow State University . ... Physicists from Lomonosov Moscow State University studied the dynamics of multiple cavitation bubbles excited by a fs laser superfilament and developed a new approach for their control by laser pulse energy and external focusing. For the first time an innovative method of controlling the dynamics of cavitation bubbles excited by the distributed laser-plasma source (filament) was demonstrated. ... 119991, Moscow, . ...

Еще в разделе: (Показать все результаты (>442) - phys.msu.ru/ )

... ОТЧЕТЫ СТУДЕНТОВ О ПРАКТИКЕ В САО . Лето 2001 года . ... Гришатовой Юлии . ... Для определения лучевых скоростей, FWHM (полной ширины на половине максимума) и интенсивности линия He I 6678.15А описывалась гауссианой ( рис.1 ). ... create/icat {P1} ztsh*.bdf . execute/catalog @@ set_lambda {P2} . execute/catalog @@ timing {P2} . execute/catalog @@ phase {P2} . ... create/table {P1}.tbl . ... create/column {P1}.tbl fwhm . execute/catalog @@ add_rv_curve_point {P2} {P1}.tbl . ...

Еще в разделе: (Показать все результаты (>18) - heritage.sai.msu.ru/ )

... The main field of my investigations is stellar spectrophotometry. As a result of scientific activity of our group spectrophotometric catalog was created including energy distribution data on 900 stars in the range 3200-7600AA and 250 stars in the range 6000-10800AA (Voloshina et al., Spectrophotometry of Bright Stars, ed. I.N.Glushneva, 1982, Moscow, Nauka, in Russian). ...

Еще в разделе: (Показать все результаты (>16) - uranus.sai.msu.ru/ )

The Chair of Mathematical Theory of Intelligent Systems and . ... Research . ... Information Monitoring . ... Search in Databases . ... It is possible this apparatus in an applied investigations on recognition of consecutive information. ... Investigation of possibility of using the additional (non-acoustic) sources of information for speech recognition. ... Investigations of possibilities of usage of methods of fussy logic, optimal control and others in solving of problems of speech recognition. ...

Еще в разделе: (Показать все результаты (>93) - www.intsys.msu.ru/ )

• Intelligent Systems :: Research
• Installation
• Intelligent Systems :: Research :: Computer Teacher

... Experimental and theoretical study of structure and evolution of hadrons under extreme conditions at high energies . ... Physics of the solar wind, interplanetary magnetic field and solar-terrestrial relations . ... Neutron diffraction researches of nuclear and magnetic structure of new materials and its correlations with physical properties . ... Research of fractal structure of aluminosilicates gels by a method of small angle scattering of neutrons and synchrotrons radiations . ...

Еще в разделе: (Показать все результаты (>42) - foroff.phys.msu.ru/ )

• Postdoctoral training (Neutronography)

University Satellites and . Space Science Education . ... The purpose of the developed scientific - educational program complex is creation on the Earth on the base of telemetry data of virtual model of microgravitational environment in which experiments are carried out, and virtual motion model of of the space vehicle. ... The developed program complex concerns to the class of the distributed program systems. ... Skobeltsyn Institute of Nuclear Physics, Moscow State University, 2005-2006 . ...

Еще в разделе: (Показать все результаты (>44) - cosmos.msu.ru/ )

... Institutes of Chernogolovka . The largest of all the scientific institutions of the center is the Institute of Chemical Physics in Chernogolovka , where fundamental problems of chemical physics are studied: kinetics and mechanisms of chemical and biological processes; processes of combustion, explosion, and polymerization; and mechanisms of elementary reactions involving high energy particles. ... Developments and Technologies . ...

Еще в разделе: (Показать все результаты (>13) - www.issp.ac.ru/ )

• Chernogolovka

THE REETHERM DATA BANK FOR MODELING OF GEOCHEMICAL PROCESSES WITH PARTICIPATION OF RARE-EARTH ELEMENTS K.G.Morgunov, G.R.Kolonin, G.P.Shironosova Institute of Mineralogy and Petrography SB, RAS, Novosibirsk This study was supported by the Russian Fundamental Research Foundation (Project No. 98-05-65299) and by the program Universities of Russia - fundamental researches (grant 2787) Herald DGGGMS RAS 5 (15)'2000 v.2 URL: http://www.scgis ...

Еще в разделе: (Показать все результаты (>1129) - geo.web.ru/ )

• http://geo.web.ru/COMPASS/geo.html
• Pletchov Pavel biography info
• Dictionary_L

... Experimental Study of Sound Scattering by Vortex Rings . ... The paper presented deals with scattering of sound by vortex ring moving horizontally in a stratified liquid over the flow regimes from laminar to turbulent ones. ... According to experimental data, the ring is identified as an inhomogeneity with cross section of volume backscattering governed by internal microscale which is of an order of sound wave length. ... Section : 7 ...

Еще в разделе: (Показать все результаты (>402) - acs366.phys.msu.su/ )

• AUTHOR : Gavrilov L
• Schedule : Nonlinear Acoustics in Medicine and Biology

... With the usage of on-land and satellite altimetrical measurements data some gravity map were made, averaged on one degree trapeziums, in reductions Faja, Bouguer, Glenni, which were included in the geological-geophysical international atlases of Atlantic, Indian and Pacific oceans. ... Boldirev S.A., Gajnanov A.G., Stroev P.A. Dencital inhomogeneities in lithosphere and dynamics of development of the North-West part of the Pacific mobile belt. ... Moscow, Nedra edition, 1967. ...

Еще в разделе: (Показать все результаты (>58) - geophys.geol.msu.ru/ )

• http://geophys.geol.msu.ru/shevnin/publ/117.pdf
• http://geophys.geol.msu.ru/STUDY/manual/ip1dmine.doc
• http://geophys.geol.msu.ru/shevnin/publ/109.pdf

... IMPACT: New carbon-based materials with exceptional chemical and physical properties . ... AREA: Condensed Matter Physics, Physical Chemistry, Structure and Dynamics of Atomic-Molecular Systems, Engineering Sciences and Mechanical Engineering . ... Moscow State Uiversity . ... STRATEGY: Application of ab initio methods for simulation of forbidden reflections energy spectra taking into account thermal displacements of atoms and protons fluctuations. ... AREA: Condensed Matter Physics . ...

Еще в разделе: (Показать все результаты (>46) - hpc.msu.ru/ )

• APPLICATIONS: Structure and Dynamics of Atomic-Molecular Systems | Moscow
• APPLICATIONS: Engineering Sciences and Mechanical Engineering | Moscow
• APPLICATIONS: Plasma Physics | Moscow University Supercomputing Center

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>23) - mouse.genebee.msu.ru/ )

LOCAL TSUNAMI WARNING AND MITIGATION ________________________________________________________________________________________________________________________________________ HYDROACOUSTIC ANTENNA : A POWERFUL TOOL TO FORECAST TSUNAMIGENIC EARTHQUAKES Yakov S. Karlik Central Research Institute MORPHYSPRIBOR , 46 Chkalovsky proezd, Sankt-Petersburg, 197378 Russia E-mail: karlik@mail.cl.spb.ru ABSTRACT Hydroacoustic antenna ... 2001). ... Eiby, J.A., 1982: Earthquakes. ...

Еще в разделе: (Показать все результаты (>21) - seac47-2.phys.msu.ru/ )

... Resources . ... Eurasian Center . for Food Security . Home About About Eurasian Center for Food Security . ... Our mission: €аPromote and coordinate collective actions for strengthening food security in Eurasia through research and development. ... The ECFS Mission should be creating conditions for the development and implementation of a coherent agricultural policy that ensures soil fertility, conservation of natural resources and ensuring food security of the Eurasian region. ...

Еще в разделе: (Показать все результаты (>62) - ecfs.msu.ru/ )

• Director | ECFS
• Forums | ECFS
• Ongoing consultations/ Текущие онлайн конференции | ECFS

AUTOMATIC CREATION OF THE HYPSOMETRIC MAP OF VENUS. ... The hypsometric map of Venus (1:45M) created under editing of Dr. Rodionova gives the representation of the planet relief on the basis of up-to-date data. ... The requirement was to preserve contour polygons with the areas more than 10 000 sq. km at the Venus surface, which corresponded with areas approximately more than 5 sq. km at the map. ... The other side of Venus map has been prepared. ... Surface height histograms for both Venus and Earth. ...

Еще в разделе: (Показать все результаты (>112) - selena.sai.msu.ru/ )

• Svetlana G. Pugacheva
• Лазарев Евгений Николаевич

MSU . Science Park . ... 2-4 June 2014, Moscow hosted the Third International Summit of technology parks and business incubators "Technoparks as new drivers of national economic development." ... To do this for three days at the III Summit held an educational seminar "Managing effective business incubators and technology parks" with American colleagues - Heads of existing industrial parks and technology transfer centers. ... JSC MSU Science Park. ...

Еще в разделе: (Показать все результаты (>14) - www.sciencepark.ru/ )

• MSU Science Park - Projects & Partners
• MSU Science Park - Prototyping center
• MSU Science Park - About us