... THE EFFECT OF CATALYST ON INTERMOLECULAR HETEROGENEITY DISTRIBUTION IN ETHYLENE/1-HEXENE COPOLYMERS . ... Copolymers of ethylene with higher 1-olefins are important class of polymer products due to their specific properties. Ethylene/a-olefin copolymers properties depends not only on the type and amount of the a -olefin comonomer in the polymer but also on its distribution along the polymer chain [1]. ...

Еще в разделе: (Показать все результаты (>184) - www.chem.msu.ru/ )

• CATALYTIC SYSTEMS

О факультете . ... Психологи МГУ . ... История факультета . ... Совет по психологии УМО университетов РФ . ... Правила приема на факультет психологии МГУ . ... Клуб выпускников факультета психологии МГУ . ... The first issue of the 'Psychology in Russia: State of the Art' yearbook was introduced at the 29th International Congress on Psychology held July 20-25, 2008 in Berlin. ... The 12th European Congress of Psychology. ... The 15th European Conference on Developmental Psychology. ...

Еще в разделе: (Показать все результаты (>170) - www.psy.msu.ru/ )

Krejnes, M. A., Morozova E. A., Chentsov, N. N. XIII Moscow School Mathematical Olympiad. Uspekhi Mat. Nauk 5 (1950), No. 5 (in Russian). ... Congress 2 (1956) (in Russian). ... Mat. ... Morozova, E.A., Petrakov, I. S. International Mathematical Olympiad (completed 2-nd publication). ... Morozova, E.A., Petrakov, I. S., Sevorcov, V. A. International Mathematical Olympiad (completed 4-nd publication). ... Morozova, E. A., Chentsov, N. N. Matrices of probabilities and stochastic supermatrices. ...

Еще в разделе: (Показать все результаты (>187) - higeom.math.msu.su/ )

Introduction to condensed matter physics . ... Physics of semiconductors . ... Computers in experimental physics of semiconductors . ... Physics of semiconductor devices . ... The course deals with the main physical principles of functioning and design of various semiconductor devices. ... Techniques of semiconductor doping and methods of semiconductor parameters control. ... Experimental studies of energy spectra of various semiconductors by optical methods. ... Physics of Semiconductors division ...

Еще в разделе: (Показать все результаты (>115) - scon155.phys.msu.su/ )

• Theory of electronic properties of disordered semiconductors and systems with
• EXAFS studies of semiconductors and ferroelectrics
• EXAFS studies of the local structure of In in PbTe, SnTe and GeTe

Title Author Key words The Other as a margin and as a marginal experience in the process of sociocultural identity formation L.Ya. ... The author singles out four basic dimensions of identity phenomenon in the frame of the proposed approach. These dimensions are located in the range between oppositional notions: individual ­ collective, internal ­ external, content ­ boundary, static nature ­ dynamic nature. ... Also the functions of the Other in the process of identity formation are revealed. ...

Еще в разделе: (Показать все результаты (>146) - www.socio.msu.ru/ )

• http://www.socio.msu.ru/vestnik/eng/archive/2015/3/11.pdf
• http://www.socio.msu.ru/vestnik/eng/archive/2015/3/03.pdf
• http://www.socio.msu.ru/vestnik/eng/archive/2014/4/05.pdf

Analysis of the ANTARES data for SN neutrino detection V. Kulikovskiy (MSU / INFN Genova) Hit counts in the detector. The number of hits ( hit counts ) in a time slice (104.8 ms) is used (this information is stored in each run) Mean number of hit counts in one PMT is ~5500 (corresponds to ~55 kHz) Expected number of hits from SN in 100ms is 11.6 ( 550 0) Bioluminescence bursts should be excluded Bioluminescence cut We have collected distributions of hit counts for each ...

Еще в разделе: (Показать все результаты (>15) - antares.sinp.msu.ru/ )

• http://antares.sinp.msu.ru/docs/2010_Amsterdam_Kulikovskiy.pdf

... Copyrightї1997 Bob Yen (byen@ix.netcom.com) (http://www.comet-track.com/hb/hb.html) . ... Information on Comet Hale-Bopp for the Non-Astronomer Hale-Bopp rotates about twice a day (3/14/97) . ... The Comet Observation Home Page was been selected to receive the Griffith Observatory Star Award for the week of February 2 - 8, 1997 for excellence in promoting astronomy to the public through the World Wide Web. ... Typically, about 1,000 individual users/computers access this page every day. ...

Еще в разделе: (Показать все результаты (>7) - www.issp.ac.ru/ )

Solar proton anisotropy and dropout effects in the polar cap and auroral zone during period of the extended substorm activity Kuznetsov S.N., and Lazutin L.L. Institute of Nuclear Physics, Moscow State University, Vorob'evy gory, Moscow, 119899 Russia Abstract. ... Dropout effects of the proton radial distribution were found suggesting specific field line stretching inside the magneosphere trapping region during period of extended substorm activity. ... Fig 1. ...

Еще в разделе: (Показать все результаты (>123) - www.kosmofizika.ru/ )

• Нейтроны и космическая погода, Кужевский и др.
• Я. И. Фельдштейн, Ю. И. Гальперин , ч.6 Список литературы
• Магнитосферно-ионосферное взаимодействие ( M-I coupling)

... Географии мирового хозяйства . ... Выберите кафедру . ... Кафедры . ... Учебно-методический отдел . ... НИЛ возобновляемых источников энергии . ... Distribution and composition of hydrocarbons in the coastal waters of the north-eastern part of the Black Sea . The results of the study of hydrocarbons in surface waters of the Blue and Gelendzhik bays of the Black Sea in relation to the content of lipids and chlorophyll and the concentration and composition of suspended matter are presented. ...

Еще в разделе: (Показать все результаты (>465) - www.geogr.msu.ru/ )

• CONTENT 1 (4) 2011
• Сергей Сергеевич Зилитинкевич
• journal 'GEOGRAPHY, ENVIRONMENT, SUSTAINABILITY'

Russian Interdisciplinary . Temporology Seminar: . ... Problems of theory of relativity - the Lorentz's and Einsteinean treatment of time relations and the experimental check-up of these two approaches. ... Various geometric methods of electrodynamics inclusion in the Einstein's theory of gravitation are considered in the paper ( a review of the 3-d volume of the monography: V.F. Osipov Space-time structure: vectorial algebra and analysis. ... QUANTUM LOGIC, TOPOLOGY, AND PROBLEM OF TIME". ...

Еще в разделе: (Показать все результаты (>644) - chronos.msu.ru/ )

• D. Finkelstein
• THE SYSTEM OF TIME AND ITS OWN WORLDS
• Laboratory-Division Quantum Electrodynamics of Self-Organizing Systems and

Below is a list of all of the modules that come as part of the Apache distribution. ... Access control based on client hostname or IP address . mod_actions Apache 1.1 and up . ... Sending files which contain their own HTTP headers . ... User authentication using text files . ... User authentication using Berkeley DB files . ... User authentication using DBM files . ... mod_browser Apache 1.2.* only . ... Replaced by mod_setenvif in Apache 1.3 and up . ... Support for HTTP header metafiles . ...

Еще в разделе: (Показать все результаты (>341) - oit.cmc.msu.ru/ )

• BCMath Arbitrary Precision Mathematics Functions
• Alternative syntax for control structures
• Unix/Linux installs

About particularities of intensities distribution in cross-section of powerful laser beams . ... The time of the beam aperture scanning was about 10 -2 - 10 -3 s. On occasion to measure the intensity distribution in the beam cross-section the small spherical mirrors with the diameter of about 5 - 10 mm were placed instead of mirror fringes. ... Such technique allowed by character of a luminescence corundum to investigate transformations of spatial distribution of intensity in a laser beam. ...

Еще в разделе: (Показать все результаты (>13) - optics.sinp.msu.ru/ )

... The circumnuclear GASEOUS disks are often decoupled from the circumnuclear stellar disks and are even stronger inclined to the outer disk planes; in fact, we have found a considerable `population' of inner polar rings. Inner gas polar rings are found as in spiral galaxies with the massive outer gas disks co-planar to the main symmetry planes (e.g. NGC 2841, Sil'chenko et al. 1997, and NGC 7217, Sil'chenko & Afanasiev 2000) as well in many lenticular galaxies (Fig. ...

Еще в разделе: (Показать все результаты (>50) - sn.sai.msu.ru/ )

• http://sn.sai.msu.ru/~sil/preprints/postbr2.pdf
• http://sn.sai.msu.ru/~sil/preprints/n7217_aa.ps.gz
• http://sn.sai.msu.ru/~sil/preprints/204780.pdf

Vol.1, Part 1. 2000) . ... Tarchevsky I.A., Chernov V.M., Maksutova N.N., Chernova O.A., Yakovleva V.G. Interplay Between Mycoplasmas ( Acholeplasma laidlawii ) and Plants ( Pisum sativum ): Biochemical and Molecular Aspects . ... Ozeretskovskaya O.L., Iliinskaya L.I., Vasyukova N.I., Perekhod E.A., Chalenko G.I., Gerasimova N.G., Babakov A.V., Usov A.I., Piskarev V.E. Modulation of Plant Resistance by Xyloglucan Fragments. ...

Еще в разделе: (Показать все результаты (>337) - herba.msu.ru/ )

• Федорова Т. А.
• INTERNATIONAL SYMPOSIUM
• Материалы к полевому сезону

Twilight observations with MASS/DIMM B. Safonov Sternberg Astronomical Institute Moscow State University Comprehensive Characterization of Astronomical Sites, 2010 B. Safonov (Moscow State University) Twilight observations with MASS/DIMM SITE 2010 1 / 17 Why observe in twilight with MASS/DIMM? ... ASM includes 3 devices sensitive to background: guider, DIMM and MASS. B. Safonov (Moscow State University) Twilight observations with MASS/DIMM SITE 2010 2 / 17 Background in guider. ...

Еще в разделе: (Показать все результаты (>21) - site2010.sai.msu.ru/ )

... Symposium expenses . ... Abstract submission . ... 14 European Symposium on . Gas Phase Electron Diffraction . ... The deadline for abstract submission is 20 April, 2011. The abstracts have to be sent to the Symposium web address:  ed.mos2010@gmail.com .  ... Arial font and single spacing should be used throughout. The title should be centered and set with 14-point bold font style. ... The main body of text should be fully justified and set in 12-point regular font style. ...

Еще в разделе: (Показать все результаты (>15) - ged.chem.msu.ru/ )

• General Information. 14 European Symposium on Gas Phase Electron Diffraction

... Alignment Sequence . Include picture . No Picture Only Structure Structure and BP numbers Structure and Stem Energy Full Picture . Sequence name . Alignment OR sequence (without name). The usage of Alignment is strongly recommended. Alignment example: . ... ANMF CGCGGGGTAGAGCAGCCTGGTAGCTCGTCGGGCTCATA AQTRNF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAA BGTRF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAT ANMF ATCCTCTCCCCGCC---- AQTRNF ATCCGCCTCCCGGCACCA BGTRF ATCCGCCTCCCGGCACCA . ...

Еще в разделе: (Показать все результаты (>215) - www.genebee.msu.ru/ )

• vanyushin_dept
• Screening pattern or alignmemt against PROTEIN databank

... Experiments and computer simulations of low-energy boron monomers and decaborane clusters implantation were performed. Molecular dynamics simulations of B10 cluster implantation have shown similar implant depth but different damage density and damage structure compared to monomer (B1 ) ion implantation with the same energy-per-atom. ... Therefore, the depth profile of B atoms by cluster implantation was the same as that by B monomer ions at the same energy per atom. ...

Еще в разделе: (Показать все результаты (>125) - danp.sinp.msu.ru/ )

• http://danp.sinp.msu.ru/LAS/Nimb256_07_21Teplova.pdf
• http://danp.sinp.msu.ru/Articles_GSIB/nimb206_902_Yamada_largeClasterIonCurrent.pdf
• http://danp.sinp.msu.ru/Articles_GSIB/nimb_GCIB_energydistribution.pdf

Site navigation: . Home . ... FAQ . ... SPDC Laboratory . Quantum Electronics Chair . ... Site configuration . Home / FAQ / Quantum key distribution / . Error: You currently have Javascript disabled. This website uses Javascript for many elements such as the menus and page customization. Please enable Javascript in your browser for the optimum website experience. This page redirects to: en.wikipedia.org/wiki/Quantum_key_distribution . Site search . ...

Еще в разделе: (Показать все результаты (>123) - qi.phys.msu.ru/ )

• Sergei Kulik: Scientific interest
• Publications :: Quantum Information Laboratory

... THE ANALYSIS OF SEGMENTAL STRUCTURE OF EEG ALPHA ACTIVITY IN HUMANS. M. V. Lomonossov State University, 119899, Vorobievy Gory, Moscow, Russia Phasic organisation of human EEG alpha activity was studied in a pilot investigation using a previously suggested EEG segmental analysis methodology. ... The segmentation procedure enabled effective identifying of the periods with different amplitude in alpha band and the short-term transitions between them. ... 1999. ... 2000. ... Intern. ... Brain Res. ...

Еще в разделе: (Показать все результаты (>63) - brain.bio.msu.ru/ )

• Other prospects of the change-point based analysis
• S.Borisov